Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig82
Contig Information
Length 770 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12p20    rwhsd12p20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_02376 [Oryza sativa Indica Group]
Score 795
Evalue 6.02133e-83
Total Hit Count 103
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig82
CGGCACGACGGGGTGAAGAGCTACTTCAACAAGTCCATCGGCAGGCCGGCCAGCAACAACAGCAGCAACAACAACTTCAGCGGCTACGGCGGCAAGAAGG
GCGCTGCCGACGGCAAGAAGAAGCACGCCAAGAACGAGCGAGGGGACAACAACCATGGCGCGGCCTCGGAGAAGCGGTTCAAGACGCTGCCGGCGTCCGA
GGCGCTGCCCCGGAACGAGCCCATCGGCGGCTACATCTTCGTCTGCAACAACGACACCATGGAGGAGAACCTCAAGAGGCAGCTCTTCGGGTTGCCATCC
AGATACAGAGATTCAGTGAGGGCGATCAGGCCGGGGCTGCCCCTCTTCCTCTACAACTACTCCACCCATCAGCTCCACGGCATCTTCGAGGCTGCGAGCT
TTGGCGGAGCGAACATCGACCCGGCGGCGTGGGAGGACAAGAAGTGCAACGGCGAGTCTCGCTTCCCTGCACAGGTGCGGGTGGCTACAAGGAAGATCTG
CGACCCGCTGGAGGAGGACGCCTTCCGCCCGATCCTGCACCACTACGACGGGCCCAAGTTCCGGCTGGAGCTCAGCATCACCGAGGCTCTCTCCCTTCTC
GATATATTTGAAGACAAGGACGATTGAGGCTGCCTACTGCTGCATGCTCAATGCTGATCAGGGAGGGACTGTTGAGGAAGGAACAGCGCAATAAGATCGA
TCGGAGCATATATACATACATACGATTAATATCATTATCAATTAATGCAATGGTGATATATACGTGAGTT
page-top