Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig79
Contig Information
Length 1190 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12p15    rwhsd12p15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0158900 [Oryza sativa (japonica cultivar-group)] >gi|54290194|dbj|BAD61082.1| unknown protein [Oryza sativa Japonica Group] >gi|113531611|dbj|BAF03994.1| Os01g0158900 [Oryza sativa (japonica cultivar-group)] >gi|215694926|dbj|BAG90117.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2018
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig79
CGCCGCTCCTTCCCCCACCTGGGGCTGCCCCAAGTGCCGCGTCGCCTACCCCAAATCCCAGACCCCCACCTCCTACCACTGCTTCTGCTCCAAGACTGAA
GACCCTCCCGCGGACCCCTGGATCCTTCCCCACTCCTGTGGCGACGTCTGTGGCCGCCGCCTCAATTCAAACCCCGACTCCGGCTGCGAGCACACCTGCC
TCCTGCTTTGCCACCCTGGACCATGTCCTCCCTGCCCAGCTGTTGTTCCTAACGCTCGGTGCTTCTGCGGGGCACACCGTGAGCCCCGGCGCTGTGCACA
TCAGCGCTATTCTTGTAAGGGTAAATGCAATAAACGTCTTAGCTGTGAACTCCACCGTTGTCCGGTGGATTGCCATGATGGGCCATGCCCACCGTGTGCT
GTGCGGGGGAATCACAAATGTGAGTGTGGAGAGACAATGGTGGAGAGGCTGTGCTCTGAAAGAGTTTTCCAGTGTAAGAGGGAGTGTAGTGGGATGCTGG
AGTGTGGGAAGCATCGGTGTGAGAGGGGATGCCATGGTGGGAAGTGTGGGGAATGTCCGCTTCGTGGGCAGCGGACTTGCCCTTGTGGCAAGAAGGATTA
TCCAAGGTTGGAGTGTGATGTGGAGGCCGCGACATGTGGATCGACTTGTGAGAAGGTGCTTGGGTGCGGACGGCACAAGTGCCCCGAGCGGTGCCATCGT
GGCCCGTGTGACGTGACCTGCCGGCTTGTGATAAAAAAGTCCTGCCGCTGTGGTGGTCTGAAGAAGGAGCTGCCTTGCCACCAAGACTTGACCTGCGAAA
GAAAATGTCAGCGTTTACGTGCCTGTGGACGCCACGCTTGTAAGCGACGTTGTTGTGTTGGGGATTGCCCACCCTGCGCAGAGACTTGTGATAGGAGGCT
CAGATGTGGAAACCATAAGTGTCTCTCTCCATGCCACAGAGGCGCTTGTTCACCTTGTCCTTTGATGAAGACCATCTCATGTTTCTGTGGGAAAACATAC
TTTGAGGTTCCTTGTGGGACCGAGAAGAATCAAAAACCTCCCAAATGCTCAAAAAGATGCAATATAGATCGTCTTTGCAGACACAAGCTTGAATGCCGGC
CCCATAAATGCCACTATGGAGCCTGTCCACCTTGCAAACTGATCTGCGGGGAACAACTTTCTTGTGGCCACAAGTGTAAAGAAAGGTGTC
page-top