Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig78
Contig Information
Length 890 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd1a22    rwhsd1a22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 976
Evalue 8.00801e-104
Total Hit Count 263
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig78
GATTTGACAGACCTGAGCACCTTGAGGTCATGGTTAAACCTCCCATGGGCACCAACGATGGAGTATGAGATATACAAGGCTGCAAATTCCATACATGGGT
ATTGTAAGGTTGGAAAGCTGAATCCAGAGAAGTCCATTCCTGATTCAATTCTTAGACAAGCAAAGGGACTTGCTATAATTACTGTGGTAAAGGTTGGAAT
GATGGTCACGTACAAAATTGGTACTGGGCTGGTTATTGCTCGCAGAGCTGATGGTTCTTGGTCTCCTCCTTCGGCCATATCTACTTGTGGTGTTGGATAT
GGAGCTCAGGCTGGCGCTGAGTTAGCTGACTTCATCATTGTTCTGAGGAACACTGATGCAATTAAAACATTCAGTGGAAATGCACATCTGTCACTTGGGG
CTGGTTTCGGTGCTGCTGCTGGTCATCTTGGACGGGTGGCAGAGGCTGATTTCCGTGCCGGTGATGGTGGTTATGCTGCCTGTTACACATACAGTTGTAG
CAAAGGCGCCTTTGTGGGATGCGCACTCAATGGAAGTGTAGTATCAACCCGAAACAACGAAAATGCCCGATTCTATGGCGGTCCAGTCAAGGCATCAGAA
ATCCTTCTTGGTTCACTGCCCAAGCCACCTGCGGCCGCCACTCTCTATAAAGCTCTATCCACACTATTTGATAAGATCGGAAAGTAATCTTCGTCTTTTC
ATGTGGTGACACACATTGTGTCCCTGTTGGTCGTCACCTTTCGAGCTTCAGTGTCTCTCTAGGTAATTTGCTTGTTTGCTAATTCCTGGGTGTCAGTCAA
GCAACTGTACAGTTTGCCATTCGTTGGTACGTCAAACAGGTCATCTATCCAGTGCCAGAAACTACTCTGTAAATGTTGTACATATGATCA
page-top