Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig77
Contig Information
Length 1312 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12p06    rwhsd12p06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0703400 [Oryza sativa (japonica cultivar-group)] >gi|2073375|dbj|BAA19856.1| farnesyl pyrophosphate synthase [Oryza sativa Japonica Group] >gi|4063829|dbj|BAA36276.1| farnesyl diphosphate synthase [Oryza sativa Japonica Group] >gi|21039025|dbj|BAB92292.2| putative farnesyl pyrophosphate synthetase [Oryza sativa Japonica Group] >gi|113533531|dbj|BAF05914.1| Os01g0703400 [Oryza sativa (japonica cultivar-group)] >gi|215692629|dbj|BAG88049.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1662
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig77
GCTCCTCGCTTCTCATCCTCCTCCCCAACTCCAATACTCTCCACAGAAATCTCCGCTCCTTCTCGTCCCTTCTCGCTCGCGTGCGCGTGGGGTGCGCAAT
GGCGGCGGCGGCAGTGGCGTTGTCGAACGGCTCCGGTGGCGACTCCAAGGCCGAGTTCGCGGAAATATACAGCAGGCTCAAGGAGGAGATGCTCGAGGAC
CCCGCCTTCGAGTTCACCGACGAGTCGCTCCAGTGGATCGAGCGCATGCTGGATTACAATGTCCTAGGAGGAAAGTGCAACCGTGGGCTCTCTGTCATCG
ATAGCTACAAGACATTGAAAGGTGTAGATGTTTTGAGGAAGGAGGAGACGTTTCTTGCCTGCACCCTTGGTTGGTGTATTGAATGGCTTCAAGCATATTT
TCTTGTGCTTGATGATATCATGGACAACTCCCAGACACGACGGGGCCAGCCTTGCTGGTTTAGGGTGCCTCAGGTTGGCCTTATTGCTGTAAACGACGGG
ATTATCCTTCGCAACCATATTTCACGGATCCTTCAACGCCACTTCAGAGGAAAACCGTATTATGTTGATCTCATTGATTTGTTCAATGAGGTTGAATTCA
AGACGGCTTCAGGGCAGTTGTTGGATCTTATCACTACTCACGAGGGAGAAAAGGATCTCACAAAATATAACTTGAATGTTCACCGGCGCATTGTGCAATA
CAAGACAGCATACTATTCATTTTATCTTCCGGTTGCATGTGCATTGCTGCTGTCGGGTGAGAATTTGGATAACTTTGGCGATGTAAAGAACATTCTTGTT
GAAATGGGAACATACTTTCAAGTTCAGGATGATTATCTAGATTGTTTTGGAGATCCTGAATCTATTGGCAAGATTGGAACTGACATTGAAGACTACAAGT
GTTCCTGGTTAGTTGTGCAAGCTCTTGAGCATGCAGATGAGAGCCAAAAGGGCATTCTACTTGAAAATTATGGGAAGTCAGATCCAGAGTCTGTTGCAAA
AGTGAAGGATCTGTATAAAGAACTTGATCTGGAGACGGCATTTCACAAGTATGAGCGGGAGAGCTACAATAAGCTGATCGCCGACATCGAGGCCCAGCCA
AGCAAAGCTGTTCAGAAAGTTTTGATGTCTTTCCTGGAGAAGATCTACAAGAGGCAGAAGTAGAGCTAAGCTCTTGGAGAGGTTGTTGTGCCGTTGCGTG
CTTTGGTAACTTGTTCCGTGTTCTGTGTGTGATGGTCTTATTACCGTAATGTACAGCGTGTTATTCCTTCCAACAATAAACTACGGTGCTATTTTTTAGT
GGTGCGTGAACC
page-top