Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig72
Contig Information
Length 679 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12o12    rwhsd12o12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0377700 [Oryza sativa (japonica cultivar-group)] >gi|75167666|sp|Q9AS33|NPL4_ORYSJ RecName: Full=NPL4-like protein >gi|13365982|dbj|BAB39260.1| NPL4 -like protein [Oryza sativa Japonica Group] >gi|113532615|dbj|BAF04998.1| Os01g0377700 [Oryza sativa (japonica cultivar-group)] >gi|125526006|gb|EAY74120.1| hypothetical protein OsI_02003 [Oryza sativa Indica Group]
Score 661
Evalue 1.96916e-78
Total Hit Count 202
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig72
GCGAGGTGGTCCAGGCCGCCCAGCTGCAGGCGGAGGGCGGGATCCCGGAGTGGGTCACCGCCGTGGTGAAGCTGGAGGTGGGGGAGGACGGCATCGGCGG
ACGTGCACTTCGAGGCGTTCCAGATGAGCGAGGTCTGCGTCAAGCTGTTCAAGGACGGCGTGCTGGAGACGGAGATCCAGGACTCCGACGACCCCCGCCT
CTCCAAGATGCGCAAGGAGGTGATTGCAGGAGGGAAGGACACCATGGAGGTGGACAACGACTTCTTCCTGGTGCCGGTGAAGATCTCCGATCACCAGGGC
CCGCTCTCAATGGGATTTCCGATTGAAAACCGTGGGATTCCTCTGCCGGCGAACGCTCTCAGGAGCCACATGGATCGTGCAAAGCATCTCCCGTTCGTCA
AGCGGATCTCTGATTTCCACCTGCTTCTCCAGATCGCTGCTTTCCTGGATGTCAAGGCCGACGTGCCTACTCTGGCTGCGTGCGTGGGACACCAGGCCGA
GGTGCCAGAGGGCTACCGGCTCCTGATCGACGCCTTGGCAGGTCAAACATAACCAGAGAGGGTTTCCTGAAACAAAGACACGGTGTCATTTAGCAGCTTG
CTCTCAGTATCATCTCATGTGTGATTTATATGAATGTCTCAGGTGTGTAAGTCTTGTTTAAAACTCGTATATGCGATAC
page-top