Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig71
Contig Information
Length 680 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12o09    rwhsd12o09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0231700 [Oryza sativa (japonica cultivar-group)] >gi|75294967|sp|Q75GA5|TIP41_ORYSJ RecName: Full=Probable aquaporin TIP4-1; AltName: Full=Tonoplast intrinsic protein 4-1; Short=OsTIP4;1 >gi|46485863|gb|AAS98488.1| putative tonoplast membrane integral protein [Oryza sativa (japonica cultivar-group)] >gi|113578530|dbj|BAF16893.1| Os05g0231700 [Oryza sativa (japonica cultivar-group)] >gi|125551431|gb|EAY97140.1| hypothetical protein OsI_19062 [Oryza sativa Indica Group] >gi|125593384|gb|EAZ33443.1| hypothetical protein OsJ_016926 [Oryza sativa (japonica cultivar-group)] >gi|215704178|dbj|BAG93018.1| unnamed protein product [Oryza sativa Japonica Group]
Score 510
Evalue 5.25114e-50
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig71
ATGCAAGGGCTGGTCATGGAGGTCATCCTCACCTTCTCCCTCCTCTTCGTCGTGTACGCGACCATCATCGACCCGCGGACCACGGTGCCCGGCTACGGTC
CGATGCTCACCGGCCTCATCGTCGGTGCCAACACAATTGCCGGCGGCAACTTCTCCGGCGCTTCCATGAACCCAGCTAGGTCCTTCGGGCCCGCGTTGGC
CACTGGGGTGTGGACCAACCACTGGGTCTACTGGGTCGGCCCGCTGGTCGGCGGCCCCCTCGCCGGGTTCGTCTATGAAACGGTGTTCATGGTGACGAAG
ACGCATGAGCCTCTACTTGGTTGGGACTTTTAGAAAAGCAGGTTGCTCGCATACTTGCATTTATATTTTGCGATGTATACCAGTGTGTATAAGGCAATCG
ATGTTGCTGATAGATTTTCAGGCAATGTGAATCTAGCTAGGTGTTGAAATGGTTTGTAGGGAGCAGCGACTAAAGTGGCTGTTTTTTTTGGTTGTTAAAA
GCTTTGATTAAAAGGCTAATAATCAGCCGTGTAAATATATTTGTTTGGAAGACGTGAATTTCAACCCATTAGAGGTGTGATTTTTCTTTAGTTCTATTAG
AGGTGTGATTGGTGTTGCGAATCANGGACAAACCTTTTGTGATATACTTGCATTTACATTTTGCGATATAAAAAAAAAAA
page-top