Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig69
Contig Information
Length 726 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12l15    whsd18p14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit fructan 1-exohydrolase [Triticum aestivum] >gi|206598528|gb|ACI16117.1| fructan 1-exohydrolase w2 [Triticum aestivum]
Score 1206
Evalue 1.97418e-132
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig69
ACTCCCTCTCCTCTCCTCTCTCCCCCCACATCTGCCGCCATGGCCCAAGCTTGGGCCTTCCTCCTCCCGGTCCTCGTCCTCGGCTCCTACGTAACCAGCC
TCTTCTTCCCCAGCTATATATCCAACCCCCTCTGCGGCGGCGATGGGGGCAGATCCTTGTTCCTCTGCGCGCAGGCTCCCAAGGACCAGGACCCGTCTCC
TGCTGTCAGCACCATGTACAAGACCGCCTTCCACTTCCAGCCCGCCAAGAACTGGATGAACGATCCATCTGGACCAATGTACTTCAATGGCATCTACCAT
GAATTCTACCAGTATAATCTCAACGGTCCCATTTTTGGTGACATAGTTTGGGGCCATTCGGTTTCAACAGACCTTGTCAACTGGATCGGGCTTGAACCCG
CGTTAGTACGGGATACCCCAAGTGACATAGACGGTTGCTGGACCGGCTCAGTCACCATTCTGCCTGGTGGTAAACCGATCATCATATACACTGGTGGCGA
CATAGATCAACATCAGGCACAAAACATCGTGTTTCCCAAAAACCGGTCTGACCCGTACCTGAGGGAATGGATCAAAGCACCCAATAACCCGGTGCTCCGA
CCGGACGAACCAGGGATGAACTCCATCGAGTTCAGGGATCCGACAACCGGTTGGATCGGACCGGACGGACTGTGGAGGATGGCAGTTGGGTGGTGAGCTG
AACGGCTACAGTGCTGCGCTTTTGTA
page-top