Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig66
Contig Information
Length 1276 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12n21    rwhsd12n21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0869900 [Oryza sativa (japonica cultivar-group)] >gi|71153743|sp|Q5N942|SAPK4_ORYSJ RecName: Full=Serine/threonine-protein kinase SAPK4; AltName: Full=Osmotic stress/abscisic acid-activated protein kinase 4 >gi|15408695|dbj|BAB64101.1| serine/threonine protein kinase SAPK4 [Oryza sativa Japonica Group] >gi|20160874|dbj|BAB89813.1| serine/threonine protein kinase SAPK4 [Oryza sativa Japonica Group] >gi|46917336|dbj|BAD18000.1| serine/threonine protein kinase SAPK4 [Oryza sativa Japonica Group] >gi|113534461|dbj|BAF06844.1| Os01g0869900 [Oryza sativa (japonica cultivar-group)] >gi|125528522|gb|EAY76636.1| hypothetical protein OsI_04590 [Oryza sativa Indica Group] >gi|125572787|gb|EAZ14302.1| hypothetical protein OsJ_004127 [Oryza sativa (japonica cultivar-group)]
Score 1063
Evalue 4.66752e-161
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig66
CGGGTCGGGCACTTCGGGGTGGCGCGGCTGATGCGCAACCGCGAGACCCGCGAGCTCGTCGCCGTCAAGTGCATCGAGCGCGGCCACCGGATTGACGAGA
ATGTCTACAGGGAGATCATCAACCACCGCTCGCTGCGCCACCCCAACATCATCCGCTTCAAGGAGGTGGTACTGACGCCAACAAATCTTATGATTGTCAT
GGAGTTCGCAGCAGGTGGGGAGCTGTTTGAGCGAATCTGTGATCGTGGGCGCTTCAGTGAGGATGAGGCAAGGTATTTCTTTCAGCAGTTGATCTGTGGT
GTGAGCTACTGCCATCACATGCAAATATGCCATAGAGATTTGAAGCTGGAGAATGTTCTCTTGGATGGCAGTGCAGCTCCACGGCTCAAAATATGTGATT
TTGGCTACTCCAAGTCATCAGTACTGCATTCAAGGCCCAAATCAGCAGTGGGGACGCCAGCATATATTGCACCAGAGGTGCTATCCCGCCGGGAGTATGA
TGGAAAGCTTGCAGATGTGTGGTCTTGTGGGGTGACTCTTTACGTCATGCTTGTGGGAGGCTATCCATTTGAAGACCAGGATGACCCAAAGAATATACGC
AAGACCATTCAGCGAATAATGTCCCGTGCAATATACTATACCTGATCATGTCCACATATCCATGGAATGCCGACAGCTTATGGCCCGTATCTTTGTTAAC
GTCCCATCGAAGAGAATCACGATGAGGGAGATAAAGAGCCACCCATGGTTCCTGAAGAACCTGCCAAGGGAGCTCACAGAGACGGCGCAGGCCATGTACT
TCAGGAGGGATAATGCCGTGCCTTCTTTTTCAGAGCAGACTTCAGAAGAGATCATGAAGATTGTCCAGGAGGCAAGGACCATGCCAAAGTCATCCAGGCC
AAGCTATGGTTGGGGCGATGAGGGTTCAGACGACGAGGAAGAGAAGGAAGAGGAAGAGAGACCAGAAGTGGTGGAGGAGGAAGAGGAGGATGAGTACGAC
AAGAGGGTCAAGGAGGTTCATGCAAGCGGAGAGCTCCGCATGAGCTCGCTACGCATATCATGAAAGTATGCGGAGTAAGTTACCTGTAGATAGTCGGCCT
ATCGTGGAACTTCTGCGCTCAGTGGGGTATGCAATTTTTGCTGGAAGTTTGCTTCTGTTTGGTTTTGGTTCCTGTAACATAATTTACATGGGACAAAGGG
GGCTTGATGAATGCTGTAATATTTGGCTCTTGACAGAGAAACTTATGTACATATAAAGCTTATGCTTGTATTCCCC
page-top