Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig65
Contig Information
Length 757 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd11m16    rwhsd11m16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 384
Evalue 1.40639e-44
Total Hit Count 85
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig65
AAAACTGTTCCAATTGGGCCAAATTATCAGGCTGAGTTGCCAGAGTGTGCATCTGGTAATTGTAGGAGCTCAGTTGATGGTAATGCTGATGTGTCATCAT
CTTCTCACATATGTGATATAAAGGAAGCCGGGAGTGACAAGTGGATTAGGAACTCTGTTATTCCAATGCCTGGTTCTGTTGAGTTATCTTCAGTGCTGAA
ACCTGTTTGCTGTAAGACAGATTGCAGTTGTGTTGATGAAGGTTCGATTGCGTGCGTGAGGAAGCATGTGAAGGAAGCAAGAGAAAGACTAATGAGTGCC
CTTGATCTGAACACCTTCAAAGAGTTAGGATTCTTTGACATGGGAGAGGAGGTGGCCTTGAAATGGACTGAAGATGAAGAGCATTTGTTCCAGGATGTGG
TATCATTAAACCCTGCCTCTCTTGGAAGGAACTTCTGGGATGAACTTCTGCTTGCCTTCCCATTGAAGACTAACAAAGAGTTAGTGAGCTACTATTTCAA
TGTCTACATGTTGAGGAAGAGGGGCTGAGCAGAATAGGTTTGATCCAATGAATGTTGACAGTGATAATGATGAATGGGAGGGAAGAGATGATGATGAATT
TGCTGTGACAGAAAGGGCTGGTGAGGATTTGCTGCTCGAGTCTCTTACTGATCAAGATGATGGTGCATGCAATCAAGTTCCCCTCCAAGGAAATATGCAT
GAAGAGTCTGGTGAGGAGGATGAGTTTGACTGTTCTAGTGGTGACAGGCAAGAAAAA
page-top