Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig62
Contig Information
Length 841 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd11m21    rwhsd11m21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0501300 [Oryza sativa (japonica cultivar-group)] >gi|53749369|gb|AAU90228.1| 'putative 1,4-benzoquinone reductase' [Oryza sativa (japonica cultivar-group)] >gi|113579520|dbj|BAF17883.1| Os05g0501300 [Oryza sativa (japonica cultivar-group)] >gi|125552884|gb|EAY98593.1| hypothetical protein OsI_20508 [Oryza sativa Indica Group] >gi|215765496|dbj|BAG87193.1| unnamed protein product [Oryza sativa Japonica Group]
Score 936
Evalue 3.17433e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig62
GCTCACCCATTAACACCGGAGCCGTCCTCCTCCTCCTCCTCCCCCCACCAGATCTCAGATCCGCGGAGCTCCGCCGCGCCTCCCATGGCGGTCAAGGTCT
ACGTCGTGTACTACTCCATGTATGGTCATGTTGCTAAGCTAGCTGATGAGATCAAGAAAGGTGCTTCATCTGTCGAAGGCGTGGAGGTTAAAGTGTGGCA
GGTCCCTGAGATCCTGAACGAGGAAGTCCTTGGCAAGATGGGCGCCCCGCCCAAGACCGACGTGCCGGTGATCTCCCCGCAGGAGCTGGCGGAGGCGGAC
GGCGTCCTGTTCGGGTTCCCGACGAGGTTCGGCATGATGGCGGCGCAGATGAAGGCATTCTTCGACGCGACGGGCGGGCTGTGGAGGGAGCAGAGCCTGG
CGGGCAAGCCGGCGGGCGTGTTCTTCAGCACGGGCACGCAGGGCGGCGGGCAGGAGACGACGCCGCTGACGGCGGTGACCCAGCTGACCCACCACGGCAT
GGTGTTCGTGCCGGTGGGGTACACGTTCGGCGCCAAGATGTTCGACATGGACAAGGTGCAGGGCGGCAGCCCGTACGGCGCTGGCACGTTCGCGGGGGAC
GGGTCGCGGTGGCCGTCGGAGATGGAGCTGGAGCACGCCTTCCACCAGGGCAAGTACTTCGCCGGCATCGCCAAGAAGCTCAAGGGCTCCTCCGCCTGAG
TGCATGATCATTGATCACCTGATCACTGGTGGTGTGTTGCTGCTGCTGCTGCTATCTGTATCTGTGGAGCTTAAGTTTGATGTGTGATGTGGGCATTGTT
ATGTTAATTATTATGGCTTTGATTGAACCGGTTGTAAAGTT
page-top