Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig61
Contig Information
Length 672 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd11m22    rwhsd11m22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit rhodopsin-like receptor [Zea mays] >gi|195657867|gb|ACG48401.1| rhodopsin-like receptor [Zea mays]
Score 78
Evalue 6.37343
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig61
AGGGATCGGCTCCGCCGCCGACGCCGAGAGAGGATGAGCTACCAGCAGGTCCCTCCGCAGGAGTCCTACCCGCCGCCAGGGTATTCGCCGGTGTACCCGC
CGCCGGCCGGCGGGCAGCAGGGCCCGTACTACCCGCCGCAGCAGCAGCAGCCGCCGCCGCCTCCGGGGTACCAGGGATACTTCAGCCAGGGCCAGCCACA
GCAGCCACCGCCCTACTACTACCCGCCCCCGCCGCCGCACAGTGGCCATCACCACCACGGCCACCACCACCATGACCACCACGCCGAGGACCACCACCAC
CACCATGGTCATCATCACCACCACCACCACAACGACGATGACTGCTGCCTTGGCTTCCTCAAAGGATGGTTGGCCGCTCTATGCTGCTGCTGCTGTCTGG
AGGAGTGCTGCTGCTGTTTCTGGTAATGTGCGTGCTTGGAAGCTACTCGTGTCTTGCATGTTCGACATTGGGCATGCCGCAGTATCCAGTGAATCTTCTG
GCTTGTTATTATGTGTAGCTATATGAACTTAGTCTGTTACCTGTGTCAAATAAACTGTGTTTACATTGTTTGCTGAACTGCTTGGGCCATGGATGAAGCG
GTGTTGTGCCAAAGTGTACCATGATCCAGACTTGACTGTATTTTATTGGTTGATTGTGGAAACTTGGTGCTG
page-top