Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig60
Contig Information
Length 773 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12m17    rwhsd12m17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13106 [Oryza sativa Indica Group]
Score 787
Evalue 5.13847e-82
Total Hit Count 86
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig60
GAAGGCATGAGCTTTGTTTTGTATTTTAGGCTTTCCGAAGGTTACTCAAAAGAGCTTTCACCCTTATTCATAGAGAATATCAGAAGGTTGGTTGATGATG
ATGTAGAAAAAATAAAAGGATTTCCTATGGAAACAAGTATATCATTTCGGGAACGGCTGAAGATACTTGGACGGGTGGCTAATCTGGAGGACCTTCCTTT
AAGTGCCGCGGAGAGGAAGCTAATGCATGCATACAACGAGAAGCCTGTGCTTTCTAGACCTCAGCATCAGTTTTTCCTGGGTGATAACTACTTTGAGGTT
GACATTGACATGCATAGATTTGGCTACATCTCAAGGAAAGGTTTCGAGACATTCCTGGACAGGCTAAAAATATGCATGCTAGATGTTGGGCTAACCATCC
AGGGAAACAAACCCGAAGAATTGCCTGAGCAGGTCTTGTGCTGTGTTAGGTTGAACGGGATAGATTATGCAAAGTATCAGCCACTGATGACAAACGGTGC
CTGAACTTGGTGACTTGCAAGGACCAGCTAACCATTGTTTGTTTGGGATCTGGGAGGTGGCCTGATCATGCCAAGGCGCGGCGGCGAGGCCCCTCGAGGT
TTCCGGCCAGGAAACCGGAGGCGGACTCTCCTCGTCGGTTCACCGCCGTGAGAAGCTAGCGCGAGCGGCTGCATGTAAAATCTGTATATCGTTACATGAG
CTCTGACTGCCTCTGCTGCTGTTGTTGCTGCCCCGTGATTCTGGAGCTAGTAAATATGGCTAATTTGCCCGTG
page-top