Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig59
Contig Information
Length 432 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd11n06    rwhsd11n06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_24555 [Oryza sativa Indica Group]
Score 288
Evalue 1.20488e-24
Total Hit Count 32
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig59
GCGACTATGACAGCGATGAAGATTTTGTGGTCATAAGGAGACCGCTGCTTATTGCCCAAGGAGCTCCATCCTATCTCCCTACCACGGCTGACCCCAGGGG
TGGTCATCCGAACTTATGGAGCTCATCAATGAGGCAGAAGTATGGACTGAACTCCTCAGGGGACTACACCTACAACACACTGGATCAAAATGCAGTGCGA
CCGCAGTGAGAAGCTTCTGTGTGACAGGTGATGAGGAAGGAAGGGCATGCATGGCCTTGTTGGAAGCACCTGTGCAGCATACTCGTTGTATATCGTAATA
TTCCATTGTGTAATGCACACTATATACATTTGTGCACCCATTCACCCTGTCAATCTCGAACTCATTGTACATAGTTCCATTGTTAGTGAAGATCGGCTAG
TTGGGAAGGACTTGTTGTCAACAAAAAAAAAA
page-top