Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig58
Contig Information
Length 1138 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12m14    rwhsd12m14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13649 [Oryza sativa Indica Group]
Score 1450
Evalue 1.28275e-158
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig58
CTCGTCGCCGTCAAGTACATCGAGCGCGGGGAGAAGATAGACGAGAATGTCCAGCGTGAGATAATCAACCATAGATCACTGAAACATCCCAACATCATTA
GGTTTAAGGAGGTTATTTTAACACCGACCCATCTTGCTATTGTCATGGAATATGCATCTGGTGGTGAGCTTTTTGAGAGAATATGTAAAAATATACGATT
CAGTGAAGACGAGGCTCGCTACTTCTTCCAGCAGCTTATATCTGGAGTCAGCTACTGCCATTCGATGCAAGTATGTCACCGTGACTTGAAGCTGGAGAAC
ACATTGCTGGACGGTAGTCCTGCTCCTCGCTTGAAGATATGTGATTTCGGCTATTCTAAGTCTTCAGTTCTCCATTCACAACCAAAATCAACTGTTGGAA
CACCTGCTTATATTGCACCTGAAGTTCTGTTGAAGAAAGAATATGATGGCAAGATTGCTGATGTATGGTCCTGTGGTGTGACTCTTTATGTCATGGTAGT
CGGTGCTTATCCTTTTGAGGATCCAGAAGAGCCTAAGAACTTTCGGAAGACAATTCAGCGTATCTTGAGTGTTCAGTATTCAATTCCAGATAACGTGGAC
ATATCTCCAGAGTGCAGGCACCTAATTTCGAGGATTTTTGTTGGGGATCCTGCGTTGAGGATAACCATCCCTGAAATACGGAGCCATAACTGGTTCTTAA
AGAACCTCCCCGCTGATCTGATGGACGATGATAGTATGAGCAGCCAATACGAGGAGCCTGAGCAGCGAATGCAGACGATGGACGAGATCATGCAAATTCT
AACGGAGGCCACCATACCACCTGCTTGTTCCCGTATAAACCACATCCTAACTGATGGATTCGACATGGACGATGACATGGATGACCTTGAATCAGACTCA
GATCTTGATATCGACAGCAGTGGAGAGATCGTGTATGCGATGTGAGCCATCTCTGGCGGTTATCGTACCGAAGCAAACCGTAGAAAGCAGCTGAAGGGCA
CAGGGTGACCTGATATGCTGTACCCTGTCAAAAGAGCTAGCAGCACTTTGAGAAAGAATCGTTCTGTGTTTTGCAAGCGAAGTCCCGGTCCTGTTCTGGT
TGTAATATAATGGGGGTTAGTTCCCTGGAGAAGCATCC
page-top