Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig56
Contig Information
Length 1199 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12m08    rwhsd12m08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit lecithine cholesterol acyltransferase-like protein [Lycopersicon esculentum]
Score 124
Evalue 7.9637e-05
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig56
AATCATTGTGGAGGATCTCAGATCCACCTTCACCGACAGCACGCGCTTGTCTGTGACCTCCCACCAGCAGCGCCTTGAGGTCACCCACAAAAGCGACCAA
GCAATTCCACGTTGTCACCCTCTACTACTTCACCAACGACATCGAGGAGGTCGTGGGTGAGAGCTATTGTCCTCCTTGGAGAACATGCTCGTGCCCCATG
CGTACGAAGAAGAGCTAAGACACTCGCATGGGTGCTCAAGGAAATACACCAGATTGAGCGAGAGTGTTACACAATTTATCAACAAGAGCAAAGACTCTAA
TCTGATGATGTAGGACAGCTTTAATGTGACAGAGGATCATGGTGGTCGATGGATTGTGCACCCGGTAGTAGACTAAGAAAGGAACATTATTTATGGAACA
CAATAATATTCAGAGCAGCCCTGCACTATGTGAGATTTAGAAGTTGGTACTGCCGGCGGATGCATCCATCTGCTAATCTCCTGGCACCGCGTAGACGGAG
CCAAACGAGTTGGGGCCTCCAGCCGGCTGGTAGTGGACAACAACACCGGGTTTGTTAATTACTCAACAAGTCACAGATTGATCTCTTTTTTGATTGGTTT
GGTGTGGATTATCAGGCCTGCCGCGCAATCATAGATTTATCTTTTGCTTTATGTGGGTGGACAGAAACACCCTTTCTAAAGTTTTGTAGGTATTGTAATG
AAGCACAGTAACACACTCCAGCATTCATTCTTTGCTTGATATTAGCAAACAATGTAAAATAACCAAGCTCACAACATTCTAAAGCGGTCTATTAGCTACT
TCAGCAGACAACAGACAGAAAGAAGTAAGCAGTATTTGATTTGCTCATACCCGTGGAGGCATCGAATTCTGCCCAAAGTTTGTCGCAGCACTTGTGGTCA
GCGGCGAGGATGAGCACCCACACCCGCTCCTTGTTGCCGGCCTCTGCATCCTCCTCCCTCGAAGCGGGTCTATGCGGGGAGTTGATCTAGAATATCCTAT
TGTTAGATATAACAAATAGGTGACAAGAAATAAACAAGAACTATGTAGTACAATATATGTGTCACACAGTATACTTTGAAAATGTGTAATTTGAGATTCT
GATATAGATGTGGGCCTGTAACACACCTTGAACATGCAGTAAAAATTGTTGTTTACAGTCTGATTTCTAAACCTGATGAAAACCCCTATTAAAAAGGAT
page-top