Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig53
Contig Information
Length 456 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12m03    rwhsd12m03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0514100 [Oryza sativa (japonica cultivar-group)] >gi|113649386|dbj|BAF29898.1| Os12g0514100 [Oryza sativa (japonica cultivar-group)] >gi|125536811|gb|EAY83299.1| hypothetical protein OsI_38508 [Oryza sativa Indica Group] >gi|215768129|dbj|BAH00358.1| unnamed protein product [Oryza sativa Japonica Group]
Score 335
Evalue 4.26456e-30
Total Hit Count 119
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig53
GGATTTCCCTTCTGCCCTGTCTTCGTCTATCTCCCTCTGCTCTCCTCACCTACCCCGATTCCCCTTCCCCTGTGCGATCGATACTCTCTAGGGTTCATCG
GCGGTCACACCAAGCAAGGATGACTACTTCAAGGCGTCTTGCTGACAGGAAGAGTGCGAAGTTTCAGAAGAACGTCACAAAGAGGGGCTCAGTGCCTGAA
ACTACTGTGAAGAAGGGGAATGACTATCCTGTTGGACCTATCGTGCTTGGATTCTTCATCTTTGTGGTCATAGGATCATCCTTGTTTCAGATTATCAGGA
CGGCTACTAGTGGTGGGATGGCTTAATATCAAGCTGAAAACAAGACGATCATTATCAGAGATTTATTTTATCCATGTGTCTGGGAGGCAATATCATATCT
GTACCCTGTAGCAAACTTCAACCCTGATGATGTTATGTAGAGATTTAAAAAAAAAA
page-top