Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig52
Contig Information
Length 526 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12m01    rwhsd12m01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Rpr4901.2 [Hordeum vulgare subsp. vulgare]
Score 273
Evalue 8.27814e-23
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig52
AAGCAGCTGATCCCAGCCGGAGAACCGTCCATCCGCCATGAGCGACGGGCAGGGCAATGCTCCTCCCGGAGGCTACTTCATCGGCCGTCCGGCGAACACC
GACGAGCCCAAGGAGAAAGAACCGCCGCAGGCCGTCGCTGAACCTGCTCCAGCTGCGCTGCCTACTCCTGGTGATTACTTCGTCGGCCGTCCGGAGAACC
AACGGCAGAACACGGAAACGCCGGCGCCTAAACCGGGCTTCCTTGCCAAATTCTGTCCATGCCTCGGCGGTAGTGGAGCTACCAGCTAGACCGACAAGCC
CAGCCGCCGTGCGCCGTGCGCGTGACCACGGGAGGATTTGAAGTGGAATCGGGTCCATGAGTCTCAATTCTGTATTGGAACTGTGCGAGTTCTCTTCATC
TTTGGAAGCTCTGCTCTGTTTTTCCTTCTTTCACTAGCATTTGATTCCTCCATATTCATTCGTGTAACGCCGACAAACGTAAACTCGACGAAATTGCCAT
CCGTCCCTGTGAAATGAAAAAAAAAA
page-top