Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig50
Contig Information
Length 1224 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12l20    rwhsd12l20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit mRNA [Zea mays]
Score 1654
Evalue 0
Total Hit Count 405
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig50
AGGGTACTCGGAGGAGCGGATCAGTGCGCAGCGGGTGGCGGACCACTACAGTGCCCGGTCGAATCAGACGCTCGAGGAGCGTGAGAACAGCCCCATCATC
CACCTCAAGAAGCTCAACAACTGGATAAAGAGCGTCCTGGTTCAACTGTATGCACGTCCAGGAGACTGCGTTCTAGATCTTGCTTGTGGCAAGGGAGGTG
ATTTGATAAAGTGGGATAAGGCCAAGGTTGGCTATTATGTAGGGGTTGATATTGCAGAAGGCTCGATAAAAGATTGCATGACCCGTTATAATGGTGACTC
GGATCAACAACGAAGGAAGAAGTTCAGTTTTCCTGCACGGCTTATTTGTGCTGACTGTTACGAGACTCGTCTGGATGAGTATCTATGTGAGGATGCTCCA
TTTGACATATGCAGCTGCCAGTTTGCAATGCACTACTCATGGTCAACTGAAGCACGTGCAAGACAAGCCCTCGCAAATATATCTGCATTGCTTCGTCCTG
GAGGCACATTCATTGGAACGATGCCTGATGCTAATGTCATTATTAAAAGGCTAAGAGAATCTGAAGGGATGGAGTTCGGGAACAGTGTTTACTGTATTAC
CTTTGGTGAAGAGTACACAGAAAAGAAATTCCCGGCATCCAGGCCTTTTGGTATCAAGTACAAGTTTCATTTAGAGGACGCAGTTGATTGCCCAGAGTGG
GTTGTTCCATTCCATCTCTTCAAACTACTGGCAGAGGAGTTTGATTTAGAGCTGGTTCTAATGAAGAACTTCCATGAATTTGTACACGAGTATGTGCAAA
GGCCAGAGTTTGCTGATCTCATGCGAAGGCTGGGGCCTCTCGGTGATGGACGATCGGGCCAAAGCACGCTGTCACAAGATGAGTGGGAGGCATCCTATCT
CTACCTCGCATTTGTTTTGCGGAAGCGAGGCCCTCCACCGTCCCAGCGGAGAGCTAACAATCCTAACAGAGGGAAGACGTTCCTTGCCGAGGAGGACATC
GAGTTTCTTAGCATATGAAGCAGGCTTTGCCGTCCTGGGGCTTACTAACAACTTACCGATTATATGCTTCACATTGTGGTGATGAAAGTTGTATCTTTAG
TGGCTCACCTGTGGTCTCCCCAAGGCGTATCGGATATATATAACTTCATAAGTTTAATGTATGAACGGCACGAACTAGTTACTCATGTAATTTTGCAGAG
ATGAATACATATTTAGGTGTCATA
page-top