Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig49
Contig Information
Length 651 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12k23    rwhsd12k23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative nitrate-induced NOI protein [Oryza sativa Japonica Group] >gi|86361426|gb|ABC94596.1| nitrate-induced NOI protein-like protein [Oryza sativa (indica cultivar-group)] >gi|90969895|gb|ABE02740.1| nitrate-induced NOI protein-like protein [Oryza sativa (japonica cultivar-group)]
Score 388
Evalue 6.6713e-36
Total Hit Count 108
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig49
GTCTCCTCCTCCCCCTTCCCCTCCGTCTCGCTCCTCGCCCTTATCCCCGTCCCTTTCCCCTTCCTCCCACCCGCAGCCGACGAAACTTTCCCCAAGCCCC
TCGGTGGATCGGACCGCCGCGCTCCATCCATGTCGGAGGAATCTGGTCGCCCTTTGCCCAAGTTTGGCGAATGGGACGTCAACGACCCAGCTTCTGCTGA
TGGGTTCACTGTTATATTCAACAAAGCCAGGGATGAGAAAAAGGCTGGGAATGGACAAGATACTGAATCCCCTGGCAAAGATGCCAGGACTGAGAGGGTG
GAATCTTATGCCACCAAGGCAAATTCAAAGAAGTGGTTTTGCTGCGTGACACCAAGTCCTACACAATCTTGAGGAGGACAAGCGTCGCCCGAAGAAAAAA
TGGTTGCCGAAGTATGGTCGTTTAATTTTGCTATATACATACTATCCATAAGACCTTGTAAGAGGTACCCAGGCTCCCTGGGCCATCACGATGGGTATCT
CGTAAAAGATGGGTATCTCGTAAAACTCTGAAGTGTGTGTATGTATGGTGTGAGGGTTGTCAGACACTCAGTTTGGATAAGTGAACTTCTGATTGTAATT
CTGGTCTTCCTTGTCGGTCTCGTTTTGTGTAGTAGTAGTGGTGAAGTTGAA
page-top