Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig48
Contig Information
Length 583 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd11o12    rwhsd11o12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit CAAX peptidase [Hordeum vulgare subsp. vulgare]
Score 538
Evalue 2.03304e-53
Total Hit Count 404
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig48
ATTTCAAAGAGATCTTTGGAAGTTTTGGTTTTGAGGATCAGCCGGTAATCATTGGACTGATCATTTTTATGCACACTATTATACCCGTCCAACACCTTCT
GAGTTTTTGCCTCAACCTCGTCAGCAGAGCATTTGAATTTCAGGCTGATGCTTTTGCCAAGAACCTTGGGTATGCTCCTGAGCTCAGGGGAGCCCTTGTT
AAACTACAGGAAGAGAACTTATCTGCAATGAACACAGATCCGTGGTATTCAGCATACCACTACTCCCATCCACCCCTTGTTGAAAGACTGTCTGCTCTTG
AAGACCTGGACAGCAAGAAAGAGAACTAATGGAAGATGATCTCATACTTGATGCGCATATGCCAACTGTCATGGCATAGCTTCAATCTCAATGTAATATG
GATATTTAGAGGGATTATTTATATGCATACAGGGATCCGTATGAAAACGTGCACCTCTAGATTCAGATATGTATTGTTCGTCGATTGACTTACTGTCTTA
TTGACCTATACACACAGGATTGTTGGTCCTTTAACATTGACAAATAGAAGTTGATCAGCTACGAGATGTTCATAAAAAAAAAA
page-top