Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig46
Contig Information
Length 435 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd11p07    rwhsd11p07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Theileria annulata] >gi|65305673|emb|CAI73998.1| hypothetical protein [Theileria annulata]
Score 84
Evalue 0.54003
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig46
GAGACACTTAGAGATCCGAGTGGCATGTCGGTAGAATGCTTCGGGCCTTTGGTAGTTTTGTTTCTGAACAAACGGGCTAGATCCTCCTGTACTTCGTTTC
CTTCTATCATTTGACATCAGAATGATAAACAGACAGACTGGTGCTTGCTCAACTTGTCCTGATGTCCAGCTTATTACTCCCTCTGTCCTGAATTACTTGT
CTCGGCTTTGTCTTGACGGATGTATGTAGACATGGTTTAGTGTCAGATACATCCGTATCTGAAAAAATGTACTCCCTCTGTCCCACAATATAAGAGCCTT
TTTGACACTACACTAAGTGTTAGGAACGCTCTTATATTATGGGACGAAAATGCTCTTATATTATGGGACGGAGGGAGTAAAAGACAAGTAATTTGGGAAG
GTATAATACCTTTTTACCTTTGTTCAAAAAAAAAA
page-top