Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig45
Contig Information
Length 973 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12l12    rwhsd12l12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit small Ras-related GTP-binding protein [Triticum aestivum] >gi|19919694|gb|AAM08320.1|AF488730_1 small Ran-related GTP-binding protein [Triticum aestivum]
Score 1044
Evalue 1.21157e-111
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig45
TCCTCCGCCTCCACGGCCTCCCCCAACTCCGATTCGAAATACTCCTTCCCCAGCTAGGGTTTTGCTGCCTCCGCCGCCGCCTCCCGCCAGCGTCGTCCCC
CCATGGCGCTGCCGAACCAGAACACCGTCGATTACCCCAGCTTCAAGCTCGTCATCGTCGGCGATGGCGGGACTGGCAAAACCACTTTTGTGAAGAGGCA
TCTCACTGGAGAGTTTGAGAAGAAATATGAGCCCACTATTGGTGTTGAAGTTCACCCATTGGATTTCACCACTAACTGTGGAAAGATCCGTTTCTACTGC
TGGGACACTGCTGGGCAAGAGAAGTTTGGTGGCCTTAGGGATGGATACTATATCCATGGTCAGTGTGCGATAATCATGTTTGATGTCACTTCAAGGCTGA
CATACAAGAATGTTCCTACGTGGCACAGGGACTTGTGCAGGGTGTGTGAGAACATCCCCATTGTCCTGTGCGGGAACAAGGTTGATGTGAAGAACAGGCA
GGTTAAGGCCAAGCAGGTGACATTCCACAGGAAGAAGAACCTGCAGTACTATGAAATCTCTGCCAAGAGCAACTACAACTTTGAGAAGCCCTTCCTTTAC
CTTGCAAGGAAGCTGGCTGGTGATCCCAACATTCACTTCGTCGAAGCTGTGGCCCTTAAGCCCCCGGAAGTGACCTTCGACCTGGCCATGCAGCAACAGC
ACGAGGCTGAGCTTGCGGCTGCAGCGGCACAGCCACTGCCTGATGACGATGACGATCTGATCGAGTAGAGAGAGGATCATGAGTCTTGTCTGTCTTATCA
ATCAATACTTTGAGAGCCAGAGACTGTGCGAGTCGGTTTTAGGTTGAAGGCTTGATTTGGAGTAGTCAAGCCGGATGTTTTTCCTGTCTGCCTTGCCTTG
TCTGGTGGGCTGCAAACTGTTTGTGTGACATTGATCTACATCATGTTGCTTGCCCATGGATTTGTTGTTGGCC
page-top