Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig43
Contig Information
Length 887 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12l07    rwhsd12l07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0557400 [Oryza sativa (japonica cultivar-group)] >gi|42407944|dbj|BAD09083.1| putative low molecular weight phosphotyrosine protein [Oryza sativa Japonica Group] >gi|113624453|dbj|BAF24398.1| Os08g0557400 [Oryza sativa (japonica cultivar-group)] >gi|215765604|dbj|BAG87301.1| unnamed protein product [Oryza sativa Japonica Group]
Score 869
Evalue 2.03327e-91
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig43
CCCCCGCCGCGTACTCGTCCTTGGCTCCGAACCCGACAGCGCGTGACCCGGTTAGGACTAGGAGGCGCACTACTCATCCACTTGTGGCAGCCACCAATCG
CCACGTGCACGGCCGCACTGTGACCAGTCTCCGCCAGATTCACCCTCGCGACCACTTTGCGAACCCTCCGCGGCCCGTATTCGTGGCGTCGGCGGCGGAA
GCGGAAGAGATGGCCGCGGAGGCGAGTACTCCGGCGCCGGCCGAGGCCAGCGCGAAGCCCTTCGCCGTCCTCTTCGTCTGCCTCGGGAACATTTGTAGGA
GTCCTGCAGCTGAAGCCGTCTTCCGGAACCTCGTCAGCAAGCGCGGACTTGAGTCCAAGTTTCAGATAGACTCTGCTGGTACCATAGGTTATCATGAGGG
AGATAAGGCCGACTCAAGGATGATATCAACTTCCAAGAAGCGGGGGATTGAGGTGACCTCAATATCCAGGCCTATCAAACCCTCAGATTTCCGAAATTTT
GATCTTATCCTTGCAATGGACAGGCAGAATTATGAAGACATTTTGAGCTCATTTGACAGATGGCAACACAAGGAGACTCTCCCAGATAGTGGACCCAAGA
AGGTTAAGCTGATGTGCTCCTATTGCAAGCGGCATACGGAGTCTGAAGTTCCAGATCCTTACTATGGAGGCGCTAAGGGATTTGAAAAGGTACTGGATCT
GCTGGAAGATGCATGCGAGTCATTACTTGACAGCATCGTGGCGGAGAAAGAAAACGTTTCTGCTTGATCTCAGAATGAATTTCCCTGAGCCAATGTAAGC
GTCACATTTTAATTTGATTGTACCAGGAATCAGTTGCAAAGATGTGGAATTAGCTTTCTGTGAGCCATCATCTCTCAGCCCAGATAA
page-top