Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig42
Contig Information
Length 828 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd11p08    rwhsd11p08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Proteasome subunit beta type 3 [Oryza sativa Japonica Group] >gi|215768995|dbj|BAH01224.1| unnamed protein product [Oryza sativa Japonica Group]
Score 857
Evalue 9.84123e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig42
CATTCGAACCCGGCGCCCTCCGTCCCGGCGACCTCGCGACTCCGGCCGGCCATGTCGATCTTCGAGTACAACGGCTCCGCGGTGGTGGCGATGGTGGGGA
AGAACTGCTTCGCCATCGCCAGCGACCGCCGCCTTCGGCGTGCAGCTGCAGACCGTCGCCACCGACTTCCAGCGGGTCTTCAAGATCCACGGCAAGCTCT
ACATCGGCCTCTCCGGCCTCGCCTCCGACGCCCAGACGCTGTACCAGCGGCTCGTGTTCAAGCACAAGCTGTACCAGCTGCGGGAGGAGCGCGACATGAA
GCCCGAGACCTTCGCCAGCCTCGTCTCCTCCATGCTCTACGAGAAGAGATTTGGGCCGTACTTCTGCCAGCCAATTATTGCTGGACTTGGACAGGATGAC
GAGCCATTTATTTGTACCATGGACTGCATTGGTGCAAAGGAACTTGCTAAGGATTTTGTTGTCTCAGGGACAGCATCAGAGTCCCTATATGGTGCTTGTG
AATCCATGTACAAACCCAACATGGAACCCGAGGAACTCTTCGAGACCATATCACAAGCCCTGTTGTCGTCAGTTGATCGCGATTGCCTCAGTGGGTGGGG
AGGCTATGTTCTAATTGTGACACCGACCGAAGTTCAAGAGAGAATTCTAAAGGGCAGGATGGACTAGATTATGCATGGCCTAGAATTCGTCAGCCGCTTT
CCGATGCTTCTACGCATGCTGTTTCGACATCCCTGTTGTGCCCTGGTTCCGCAGTAACCTTGTACTGTCAAACTGATGATGTTATATTTGCCCGTAGAAA
GAACATTTGTTGTGTTCTATTTCTGCTT
page-top