Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig41
Contig Information
Length 703 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd11p14    rwhsd11p14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_30569 [Oryza sativa Indica Group]
Score 473
Evalue 2.34699e-49
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig41
CTCGGCTGCCGGGTGGTGTACCTGTGCCGGGACCCCAAGGACACGCTCGTTCTCCAGGCTGCACTTCGAGAACAAGCTGGCGGCGCGGTGCGGCGGCGTC
GGCCCGTCGATGGACGACGCCTTCGGCATGTTCTGCGAGGGGTTCTCGCCCTACGGCCCCTTCTGGGACCACTGCCTCGAGTACTGGGAGGAGAGCGTGG
CGAGGCCAGACACCATCCTCTTCCTCAAGTATGAGGAGATCAAGCTGGACCCGGCGCGGGTCGTGAGGAGGCTCGCGAGCTTCCTCGGCGTCCCGCTGAC
CGAGCAGGAGGAGAGCTCCGGCGTCGCGGACAAGGTGGCGAGGATGTGTAGCTTCGAGTCGCTCACCGGGCTGGAGGTGAAACAGGTCGGCGGCGTCAGC
CACGGGAATAGAGTTCACTTTGATAACTCTGTGTTCTACAGGAAAGGCGAGGTAGGGGACTGGGTGAACCACATGAGCCGCGAGATGGGGGAGAAGCTCG
ACCGCATCGTCCAGCAGAAGCTCCATGGTTCCGGGCTCGTGTTTTGAGCAAGAGTCATTTGTCATGTGTTCTGTGCTCCTTTGCACTCTGCTGCTTCTGG
TTGGTGAGAGGAGAGCCCTATGTTGATTGTGTTTATTATTATTATTATTATCATTATTGTTTGGATTGCTTACCACATGTGTCACCGTGGTATGTTGATT
GTG
page-top