Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig40
Contig Information
Length 1044 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10d22    rwhsd10d22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0585500 [Oryza sativa (japonica cultivar-group)] >gi|48843805|gb|AAT47064.1| putative calcium-dependent protein kinase [Oryza sativa (japonica cultivar-group)] >gi|113580006|dbj|BAF18369.1| Os05g0585500 [Oryza sativa (japonica cultivar-group)]
Score 1252
Evalue 1.02356e-135
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig40
GCCTTTCTGGGCAGAGAATGAAGAAGGTATATTTGATGCTGTTCTGAAAGGTCACATTGATTTCTCGTCTGATCCCTGGCCATCGATTTCAAATGGGGCT
AAAGACTTGGTCAAGAGGATGCTACGGCAGGACCCCAAGGAGCGGCTCACGGCTGCGGAAATATTGAATCATCCATGGATCAGAGAGGATGGAGAGGCCC
CAGACAAACCACTTGATATTACAGTGATCAGTAGAATGAAGCAGTTCAGGGCGATGAACAAGCTTAAGAAGGTTGCCTTGAAGATTGTTGCAGAGAGCTT
GTCAGAGGAAGAGATCGTGGGCTTAAGAGAAATGTTCAAGTCCCTGGATACTGATAACAGTGGGACAATTACTCTTGATGAACTAAGGGCTGGCTTACCA
AAGCTTGGGACCAAAATTACTGAATCAGAAATAAGACAGTTAATGGAGGCGGCTGATGTTGATGGAAATGGGACCATTGATTATGTTGAATTCATATCGG
CAACAATGCACATGAATAGACTAGAGAAGGAAGACCACATATTTAAAGCATTTGAATACTTTGACAAGGACCACAGCGGGTACATAACAGTTGATGAGTT
GGAGGAAGCTCTGAAGAAGTATGATATGGGTGATGAGGCAACAATTAAAGATATCATTGCTGAAGTGGATACAGATCATGATGGGAAAATTAACTACCAG
GAGTTTGTTGCGATGATGAAGAACAACAGTCCAGAGATTGTTCCAAATCGACGCCGCCTATTTTAAATCTTGCAATGGTTTATGCGAAGCTTGCGATTCC
TGTGAATGCATTTAGACAGGTGACCAGTCAAGATCTTAATTGGCGAGGAATGAGCGAAGCCATTCATGCTTGGCCACGGAATTTAGTAAGGTATCTGCAA
GTGATCCTTTATACTTGGAACACACTATCCATCATTGGGAACTCTCCCCTTCAACGTGTTCTGAGCTAGGTCGCACTTTCTTGTGCTACCATGTTATACC
ATTCACATGTATCCTTATGAGTTATGACTTATGAGGCGAGCCGT
page-top