Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig38
Contig Information
Length 679 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12a12    rwhsd12a12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0750600 [Oryza sativa (japonica cultivar-group)] >gi|75134491|sp|Q6Z8K4|MUB3_ORYSJ RecName: Full=Membrane-anchored ubiquitin-fold protein 3; Short=Membrane-anchored ub-fold protein 3; AltName: Full=OsMUB3; Flags: Precursor >gi|46390208|dbj|BAD15639.1| putative NTGP5 [Oryza sativa Japonica Group] >gi|113537664|dbj|BAF10047.1| Os02g0750600 [Oryza sativa (japonica cultivar-group)] >gi|149392483|gb|ABR26044.1| ubiquitin family protein [Oryza sativa (indica cultivar-group)] >gi|215679386|dbj|BAG96526.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215694651|dbj|BAG89842.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737488|dbj|BAG96618.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218191587|gb|EEC74014.1| hypothetical protein OsI_08953 [Oryza sativa Indica Group]
Score 568
Evalue 9.88029e-57
Total Hit Count 62
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig38
GTGAGCCGGCCGGGAGATGGCCGGCGGGAAGGAGCCGATCGAGGTCAAGTTCCGGCTCTTCGACGGCACGGACATCGGCCCCAGCAAGTACGACCCCGCC
ACCACCGTCTCCGCGCTCAAGGACTTCATCCTCGCCCGGTGGCCGCAAGATAAGGAAATAACTCCAAAAACTGTCAATGACCTGAAGCTCATCAATGGTG
GAAAGATATTGGAGAATAACCGGACACTTGCCGAGTCGCGTGTTACAATAGGAGAGGTCCCTGGAGGTGTAATTACAATGCATGTGGTAGTGCGCCCTCC
ACAAGTTGACAAAAACCAGAAGCAGCTGGGCAATTCCCCCAAGCAGAACAGATGCGGATGCACCATACTGTGATACGGCACCCCCCTGGTGATGTTCGAT
GCGCCTAGTTGTAGAATTTCTCTTGTGCTTTTGTTGCGTCCACGACGCGGTGTGTATTCATTTTGACATCCAGTTCATGGAGCCATTGAAACTCGATCTA
GAAACGCATGCATGTACTCCTGAAAGCATGTTTGGGAATCTGGTGGGACTGGCTGGGAGTGAAGGTTCCTCCTTGGGATGTTGCTGATGTGTGCAGGAGT
CAAGGAATGGATCGGATGCTTGCTGTTGTGTAAATTGTAATGTGGAAACAACCATCTTTTCATTTTTCCAAAAAAAAAA
page-top