Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig37
Contig Information
Length 748 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12a13    rwhsd12a13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DNA-binding protein S1FA [Triticum aestivum]
Score 475
Evalue 7.25399e-46
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig37
CTTACGAACCATCCTCCTCGAAGAACTCCAGTGCTTATCTCCTACTCGCCCCTGGCCTAATCCATCCAATCTCTCGGTTCAGAAGGCGAGGAGGGCGCGG
TGCCTGGTCCAGATCTCGTGGCCGCCATGGCGGAGAAGTTCGCGGAGTCAGCGAACAATGTAATCATCGAAGAGGTGAACAAGGGCCTGAACCCTGGAAT
GATAGTCCTGCTTGTGGTTGCTACCACCCTGCTGCTTTTCTTTGTTGGGAACTATGCGCTGTACCTGTATGCGCAGAAGACGCTCCCTCCGAAGAAGAAG
AAGCCAGTCTCCAAGAAGAAGCTCAAGAGGGAAAAGCTGAAGCAAGGGGTTTCTGCACCAGGGGAGTGAAGAGATCCATCGATTTCGCGTGTCGATTGCT
TTATTCTGGGCTCCTCTTTACCTGATAAAAAATATATACCAGCTGGAGCTGCGGTGTTGAGCTACTGTTTATGTAGAAACCTTGTCTTGAGTGGTACATC
GTCGGTATTGGACACCTTATTTAAGCGAACTGATAAACCTTAGTCTGAATTGAGCTGCTCCTGGTTATAGTTTTTATAAATTTAAAACTTTGCTGGGGAT
CATCTGTGGCAAACTTGCGAAACCTGTGTTGCCGTTTGCAGTTTGGTATGTTGTGTTGCATTGTGGTTTGGTGTCTCTCGGGTTTTGTAAGAAGTTTTCA
AAATTTCATGCTGCCAAAAGATACTTCATCANTCTGCCAAAAAAAAAA
page-top