Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig36
Contig Information
Length 744 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12a18    whsd12b05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_024808 [Oryza sativa (japonica cultivar-group)]
Score 528
Evalue 5.14219e-52
Total Hit Count 85
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig36
GACTCGTGGTTGCTGCTAGATGTAATGTGGATGTTTACCTTATTAAGCGCTATTTCGAGACCTCATCCGGTTACCTTAACCTCGTGCCGCCTCGTGCCGA
ATTCGGCACGAGGCTTCCCCCAAATTCTCAAATCGCGAGCTCGGAACACTTGCACCCTACTCGGATAGGATCGGCGATTCGCCCCCCTAGTTCCTCGTCG
GGAACTTCAGTACAAGATGCAAAGGGGAAGGGGCGGGAGAGGTGGTCTCTTTGGTTTTGGGGACCCTTTTCCTGCTTTTGGCGGCTTTGTACCACCTGGG
AACCTTATGTCCAGTTTCTTTCGTGGGTCAAGTCCCTTTGATGATCCCTTCTTCACCAATCCTTCTGGTTCTTTGATTGGACCTAGCCTATTTGAGCAAA
GCATTTTTGGTTCAAGCATGTTCGGGCCACACACAGCTCTAAATGGAGGAGGCTTCCAGCAGCAAGGTCCTGAACCAAGCAGGCCAAAAGGGCCGGTTAT
TGAGGAGTTGTCTTCAGACGACGAGGATGGTGCGGATGCGAATGAACATGATGAGAAGAAGAAAACTAACTCTATGAAACATCCAAGGATTTGCAAAGAG
CCATATGTGGAGGACTCTGGTGATGAAGTTCAAGATAATAAGAGATCTAGGCATGAGAAATTTGGGAAAGAGTACGTCAGGGCTGGCACATCATATCAAC
AGCCACAGACCTATATGTTTCANAGCTCAACTGTTACATATGGT
page-top