Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig34
Contig Information
Length 224 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12j22    rwhsd12j22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0824300 [Oryza sativa (japonica cultivar-group)] >gi|48716318|dbj|BAD22931.1| putative AT-hook protein 1 [Oryza sativa Japonica Group] >gi|48717090|dbj|BAD22863.1| putative AT-hook protein 1 [Oryza sativa Japonica Group] >gi|113538105|dbj|BAF10488.1| Os02g0824300 [Oryza sativa (japonica cultivar-group)] >gi|125541688|gb|EAY88083.1| hypothetical protein OsI_09514 [Oryza sativa Indica Group] >gi|125584210|gb|EAZ25141.1| hypothetical protein OsJ_008624 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 111
Evalue 0.00100072
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig34
TGCAAACTAGTCGTTGTGATGAAGTAATTGATGGTGGTGAAACATTAGCTTTGGGGAGTTTTGTAGAAGAAGCAAGCATGACGATAATTGATTGCTGTAG
GAACTTTGACTCTTTTTTTTTTATTTTCCTGTGGAAGAAAAAGAAAAATCACAATTGGATTGGATGTTGAGCAACAACTTGGTTAGTCTGATCAAGATAC
GTTTACCTTGATTCAAAAAAAAAA
page-top