Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig31
Contig Information
Length 1261 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12c10    rwhsd12c10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 4-methyl-5-thiazole monophosphate biosynthesis protein [Zea mays]
Score 1466
Evalue 2.06836e-160
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig31
CCCGCGTCGCCGACCTCGAAGGCGAGGCCTTTGACCTCATCGCCCTGCCGGGCGGGATGCCGGGATCAACTAATCTTAGAGAATGTAAAGTACTCGAGAA
GATGGTCAAGATGCATGCAGAGAAGGGGGAACTCTACGGCGCCATTTGCGCTGCGCCGGCAGTGACGTTGGCCCATTGGGGCATGCTCAAAGGTTTAAAG
GCAACTTGCTACCCGTCGTTCATGGAGAAGTTCACTGCTGAAGTGATCCCTGTGAACTCCAGGGTGGTGGTGGATAGAAATGTGGTGACCAGCCAGGGTC
CAGGAACAGCAATCGAGTTTGCTCTTGCTTTGGTGGAGCAGCTATATGACAAAGAGAAGATGGAGGAGGTTGCTGGACCTTTGTATGTGCGCCCTCAACA
TGGAGCCGAGTATACCAGCGAAGAGCTTAATTCGGTTGAATGGAAATGCAGTGGTACACCTCAGGTTCTTGTGCCAGTTGCTAATGGTTCAGAGGAAATT
GAAGCTCTTAATTTAATAGATGTCTTGCGTAGAGCAGGCGCAAATGTTACAGTTGCGTCAGTTGAGGATACCCTGCAAATCGTGACCCGGCGTCACAAGT
TTAATCTGATAGCTGACATGATGTTGGACGAAGCTGCTAAAATGGAATTTGATCTGATTGTCATGCCGGGCGGTCTGTCGGGTGCTCAAAAGTTTGCTAG
TACAGACAAACTTGTTGATCTACTGAAAAAGCAGGCAGGATCTGGTAAACCCTATGGTGCAATATGTGCTTCCCCAGCTCATGTCCTCGAGCCCCACGGT
TTACTGAAGGGGAAGAAGGCGACGGCATTTCCACCCATGGCGCACCTGCTTACAGACCAGAGCCTATGTGAGAACAGGGTTGTGATTGACGGGAATCTTA
TCACTAGCAGAGCCCCAGGGACTGCGACAGAGTTCGCCCTGGCCATTGTTGAGAAGCTATTTGGTCGAGAGAAAGCAGTCAGTATAGCGAAGGAGTTTGT
TTTTATGTGATCACAAGCTGAGTTGGTGCTGTGTGCAGTGCAAAGTGCAAACTCTGTGGTTAACCCCGCCTCTGTGTAGATAATGCCTGCACTGGTAGGA
ACTGTGTGTACATTTGCTGGAACTATAGAAGCATACCGTAAACAGAGAGGTGAATGTACAGCATATTTTCCGTGTGCAACTGGAGGTATCATCTTAGCTT
CGTCGGGGAAAAGCTGAGAAACTGCAGTAAGTCCCACTTTCAATTGTTAATAAGCTGTTTG
page-top