Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig30
Contig Information
Length 1233 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12c19    rwhsd12c19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100191152 [Zea mays] >gi|194688194|gb|ACF78181.1| unknown [Zea mays] >gi|194701608|gb|ACF84888.1| unknown [Zea mays] >gi|194702662|gb|ACF85415.1| unknown [Zea mays] >gi|195638204|gb|ACG38570.1| choline-phosphate cytidylyltransferase B [Zea mays]
Score 1262
Evalue 9.16058e-137
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig30
CCGTCGCTCGCTTCCCCCCTACCCGAACCTTCTCGACTCCCTCTTCGCATGGCCGACGCGAAGGCCGAGGCGGCGAGGCAGGCGCCGCAGTCCTCCCAGG
AGGAGGAGGAGGACTGGAAGGAGGCCGAGGGGGACGTCGAGGTCGCGGACAGGTCCACGAGCAATGGCGGCGGCGGCGGCGCCGGCGAGGGGATCACGGA
CAGGCCGATCCGGGTCTACGCCGACGGCATCTACGACCTCTTCCACTTCGGCCACGCGCGCTCGCTCGAGCAGGCCAAGAAATCGTTCCCTAATGCATAT
CTTCTTGTCGGGTGCTGCAATGATGAGTTGACACATCAATACAAAGGAAGAACTGTCATGACAGAGGACGAGAGATATGAATCACTTCGCCATTGCAAGT
GGGTTGATGAAGTCATTCCTGACGCTCCGTGGGTAGTAACAGAAGAGTTCTTGAACAAGCATAACATCGATTTTGTTGCACATGATTCTCTGCCGTATCA
TGATGCTAGTGGAGCTAGTAATGATGTCTATGAATTTGTAAAAAAGCTTGGTAAATTTAAGGAGACCAAGCGCACAGAAGGAATATCAACCTCAGACATT
ATAATGAGGATTGTTAAAGATTATAATGAGTATGTTATGCGCAATCTGGCCAGGGGGTACAGCAGAAATGATCTTGGTGTCAGCTATGTCAAGGAAAAAC
GACTAAGAGTTAATATGGGATTGAAAACCCTCCGTGACAAAGTGAAGCAGCACCAAGAAAAAGTAGGGGAGAAGTGGAGTACAGTGGCAAAACTCCAGGA
AGAGTGGGTTGAAAACGCAGATCGCTGGGTTGTTGGTTTTCTAGAGAAATTCGAGGAAGGTTGCCATTCAATGGGAACTGCCATCAAGGAAAGAATCCAG
GAAAGGCTGAAGGAGGCGCAGTCTAGGGACTTCAGCCTTCTACAATACGACAGTGACGACTTTGACGACTTTGAAGAAGAAGACGATGAAGTTGCCGAAG
ATGCCAAATACGTGAAAGAATAGCGGCACTGTAAAATTTTATGTCAAAGTATAATACGGGCATGCAATGCATGTTAACAGTCTTCATCAACCGCAATCCT
TCACCATGTATCTGTCCCTTTGATCGTGAGCTTCACTGTCAAGGTAGATCTGCGTGCTGTGTTTGTAGCTGTACTTGATGTTTTTCTAGGCAGTAGCGTA
CGCTCTTGTAATAGTTCTACCTGTGAGGCATAA
page-top