Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig29
Contig Information
Length 731 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12j13    rwhsd12j13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein disulfide isomerase [Zea mays] >gi|59861275|gb|AAX09967.1| protein disulfide isomerase [Zea mays]
Score 606
Evalue 4.50124e-61
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig29
GCCGTGGCCGTCCTCCGACCGAGCCATGGATCCGGCTCTTCGGCGCCGCTCCCGCCTCCCTATCCACCTCCTGCTGGTGGCCGTCACGTTACTCGCCGCC
CTGGCCGCGCGATCCGGCGCCGAGGTCATCACCCTCACCGAAGAGACCTTCTCCGACAAGATAAAGGAGAAGGACACAGTGTGGTTTGTGCAATTCTGCG
TCCCTTGGTGTAAGCACTGCAAGAGCCTAGGAACTCTTTGGGAGGACCTCGGGAAGGTTATTGAAGGTACGGATGAAATTGAGATCGGAAAAGTTGATTG
CGGTGCAAGCAAACCAGTCTGCTCAAAGGTGGACATTCATTCATACCCAACATTCAAGGTGTTCTATGATGGCGAAGAAGTTGCAAAATATAAAGGGCCT
AGGGACGTGGAGTCTCTCAAGACCTTTGTGTTGAACGAAGCTGAGAAAGCAGGTGAGGTGAGGCCTGAAGATGAGCTATAGGTGTTCGTAGCAGGCACAT
GCCAATAGACGATGATACTCCGGTCAAGAAACTTTGGAATGCTCTCGACCTGTTTAAATTTTTCGACCAAGTTGGCTTGTACTGCCGCCTCCTGGCGCTT
GTGGCTAACTTAGAATGGTACTACGTCAGATGCAAGAAGAAAACTTTTTTGTAACTTTTAACCTTTTCAATTCAGTTAGATGAACCTGCTCGGTGCAGAC
AATTTTCGAAAAGCTATTTCTGCGGGCTGGC
page-top