Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig28
Contig Information
Length 422 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12c16    rwhsd12c16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gustatory receptor candidate 19 [Tribolium castaneum] >gi|163716740|gb|ABY40594.1| gustatory receptor [Tribolium castaneum]
Score 75
Evalue 6.09764
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig28
CGGGTTCGTCCACACACTTCCGCCGCCGACTCCGCCGCCGCGAAGAGGAGAGCGAGGCCGACTCCGCCGCCGCGATGAGGGCCAAGTGGAAGAAGAAGAG
GATGAGGAGGCTCAAGAGGAAGCGCCGAAAGATGAGGCAGCGATCCAAGTAGGCGGTAAGCATCATCTTGCATCCAGGCAGCGGAACTCTGAGGGGTGAT
GGCATTGTCTAGTGATTCTTGATTTGTTCTGTTGTTTTGGCTGTGGAAGTTGCTTTTACCTGTGTTTGGTCAAATTTAGTTGTTTAATACTAGTCTGGCT
ATGTTCCAGTACTGAGTTTTATGTAATGTGAGGATTATATGTGTTTGTGACTGAATTTTATGCAGCTATTAATTTTGCAGTACTCTGAAATATGTAATTC
TCACCTGCGTCTAAAAAAAAAA
page-top