Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig24
Contig Information
Length 700 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12d06    rwhsd12d06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Defender against cell death 2; Short=DAD-2 >gi|5918185|emb|CAB56224.1| defender against death (dad) 2 [Hordeum vulgare]
Score 558
Evalue 1.49401e-55
Total Hit Count 163
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig24
GCCTCCGCCCTGGGGCTGGATCCTTCCCGGTCCTTATCGGCCCTCTCTCTCCCGAACCCCGCGCCCCGTTCGCGGCCGGGTTTCTAGATCTGAGAGCCGC
CCTGTCCGTCCTCCGCCGTGATCTGATTTCTTGAACTCTGATCTACTAGCTCGAAGCGGCGGAAGCAAGGATGCCGAAGGCCGCGGGGGATGCCAAGCTC
CTGATCCAGTCCCTCACCAAGGCCTACGCCGCCACGCCCACGAATCTCAAGATCATTGACCTGTACGTGGTTTTCGCGGTCGCCACTGCCCTGGTTCAGG
TCGTTTACATGGGAATAGTTGGGTCATTCCCCTTCAACTCTTTCCTGTCTGGTGTCCTGTCATGCATTGGAACTGCAGTGCTTGGTGTTTGCCTCCGTAT
TCAAGTCAACAAGGACAACAAGGAATTCAAGGATCTTCCCCCGGAGAGGGCCTTTGCTGATTTCGTCCTGTGCAATCTGGTGCTCCACCTGGTGATCATG
AACTTCCTTGGATGAGCAACTGTCATACAAGCTGTCGAGATTTTGTAGTGTCCTAATGTCTAAGACTGTCAGCATGTTAGATATTCATGTGGCACCATAC
ACACCTATGTAATCCGAGAGTTTCTCTATGAACTATAAGAATTCAGTGGATTTAGTGTTAACTTTGTGGAACATGAGAACTTATTCGATTGAGTGAAGAC
page-top