Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig23
Contig Information
Length 1044 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12d20    rwhsd12d20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_00169 [Oryza sativa Indica Group]
Score 223
Evalue 2.13541e-16
Total Hit Count 29
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig23
ACGCCGTGAATCTGAGTTTAGTAGCCTAAGGAAAGAGAGGGAAGAAAGGATTAATCAGTTGCTATCTTCAAGAAAGCGTGAAAGGGAGACTGTACGCAAA
TTGATGTATTTTCTGAACATGGAGGAACAGCGGATCCAAAGGGAGCGTGAGGAACAGGAGGCTAGAAAGCGTGAAGAGGAAGAGAGGAGAAAGAAGGAGG
AAGCCGTGAGGAAGCTCAAACTTGACGCAATCGCTGCTAAGCAGCTGCAGAGGGAGAGGGAGTTAGAAGAGAGGGAGAAACAGAGAAGGGAGGCTCTCCT
AAGAGGAGCAGAGCCCGTGCGCGCAGCTGATGCACCAGCTGCTGCTGCTGTCGCACCGCCAGCCCGTGAACCAGCAGCGGCAGCCCCAGCTGCAGCAGCT
GCAGCAACTGGTGCTGCTCCTAGCAAGTATGTCCCAAAGTGGAAACGTGAGGGTGATAGTAGCAGTCAGAGGCCGACTGCGGCAGCTGAACCAGACCGGT
GGGTCCGGGATGATCGTCCTCGCCCTGCCCTCCGCCAGGATGCTCCTCCTGTGCGCGATGCTCGTCCCATCCGCCAAGAAGCTCCTCCTGCACGTGATGC
GCGTCCCTTCCGCCAGGAGGCTCCTCCCGCCGCACGCCAAGAGGCGCCCCCTGCTGCCCGCCAGCCGGACGGTGCTGCTCCAGCTGCATCTACTGAACGC
TGGCGTCCTGGATCTAGGACCTCTGCAAATTCCTCATCCACCTCCTCGTCCACCGGCTGGAGGCGCTGAAGCTGCCTGGCCTGAAATGCGCTGTGCTCTG
CCCGCTGTCTGAGATTTTTGCCGTCCTACTTCCATGTCTTGGAGCTTCATGCACAATGGAAGTCTGCCACTGATATCTGGGAGCACGGTTACTTGAATTT
GCTTGTTGCGCACCTAAATTTTCGAATTGAAACCTTGCACTGTTTCTCAGTCATGTTTGATGTTTTGAGAGTCACAGTACTCCATGCATAATGTGTTGCT
CTTTGTTGGCGTATATGTTCCAGACTATGCTGTTGTTTGTCGAG
page-top