Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig21
Contig Information
Length 420 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12f19    rwhsd12f19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit BLN1-1 [Hordeum vulgare subsp. vulgare] >gi|213138579|gb|ACJ44984.1| BLN1-1 [Hordeum vulgare subsp. vulgare] >gi|213138581|gb|ACJ44985.1| BLN1-1 [Hordeum vulgare subsp. vulgare]
Score 143
Evalue 7.72461e-08
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig21
CGCCAATCCAAGTAGAAACACAGCAAGGAAGCAAAGAGCCGACCGACCGAGGATGGCAAAGAACAACTCCTCTGCGACCTCGGTTCGGCTGATGCTCATC
CTCCTCCTTCTGCTGGTTTTCGTTGGTGGCATCCTGGCAAATAGTGGGCCGTCCGAATGCAGCAACCCTGCGGCTCAGCGAGACTGCCCGCGGATCCCTA
ATGGCGGCTCATAAGCACGAGATGAACCATTTCCGCGCAGCAGGATTCGGTAGGATCTTGTGTTGGCAGGCGCTGGAAGCTTTCTATTATATATGCGAAA
CAAACAATATACATGTTCTTGAGGTGTTGGTTTTGTGATGTTTGTTCGTATTGATATGTTTGTACTGTGACCTGGTTTACATATAAATAATATGGCCTAC
CCCGTACATTAAAAAAAAAA
page-top