Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig238
Contig Information
Length 719 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10d10    rwhcs10d10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to transforming, acidic coiled-coil containing protein 2 isoform a [Canis familiaris]
Score 83
Evalue 1.91802
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig238
CCCGTCGTCGATCCCCTCGACTCCAACTACCTCCGGCTCCCCTGAGCTCCTACGAACCCCCCTACTCCGAGACCGCTGCTGATGTTGCCCCTGTGATCGA
CTACGTCGACGACGACACTTCTTCCCTTTCAGCAGAGCTTCCAGAATTGTTGTTTTTTGCCTATTTCAGTGTTTCGAAGAAACGGAATATCAGGCGGAGT
CCAAACGGAATGAAACCTTCGGAAACATGATTTTCTCACCGAACGTGATCCAGGAGACTTGCACTCTACTCCAAGAAGTGCCAGAGGCGGTCACAAGGGT
GGAGGGCGCCCCCCTGGGCGCGCCCCCTACCTCGTGGGCCCCCTGTTGCTCCACCGACGTACTCCTTCCTCCTATATATACCTACGTATCCCCAAACGAT
CAAGGAGGAGCCAAAAACCTAATTCCACTGCCGCAACCTTCTGTATCCACGAGATCCCATCTTGGGGCATGTTCCGGAGCTCTGCCGGAGGGGGCATCCA
CCACGGAGGGCTTCTACATCAACACCATAGCCCCTCCGATGAAGTGTGAGTAGTTTACTTCAGACCTTCGGGTCCATAGCTAGTAGCTAGATGGCTTATT
CTCTCTTTTTGGATCTCAATACAATGTTCTCCCCCTCTCGTGGAGATCTATTCGATGTAATCTTCTTTTTGCGGTGTGTTTATTGAGACTGATGAATTTG
TGGGTTTATGATCCAGTTA
page-top