Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig20
Contig Information
Length 463 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12f16    rwhsd12f16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38607 [Oryza sativa Indica Group]
Score 289
Evalue 9.12199e-25
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig20
AGTCCAACTACCGCCTTGATGCTGAGGTGAAAACCTTGAGGCAGGGAGGCAGTGCTCCCTATCCGGACATAGAAGCAATAAAAGCGCAAGCCAAGGAAGA
GGCAGAGAAGGAAAGTGAGGTGGAACTGAACGATCTACTCGTCTGCCTGGGACAGGAGCAAAGTAAAGTTGAGAAGCTGAGTGCAAGGCTGGCAGAGCTC
GGTGAGGACGTGGACACCCTGCTGCAAGGTATCGGCGATGATGCTGCCTTGCCAGATGACGATGATGATGATGACGACGATGAAGACGACGATGAAAAGT
AATGTGTTTTTGCTTCACTTTCATCTATGGTGTAACCTAGCATCATTTATTGAATCATGGTGATGTGGGCTTGTGATAACAATTGTACCAGTGGAATGTT
GGTGATGTGTAGACAAAGGTGGCCATTTCATTTCTAAGTTATTTATGGATGCCAAAAAAAAAA
page-top