Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig18
Contig Information
Length 1006 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12i07    rwhsd12i07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit O-methyltransferase [Triticum aestivum]
Score 1118
Evalue 3.36611e-120
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig18
CGCCTTAGCGTCCCCCGAGGAGGGGACCTACTCCCTTGTCCCGCTATCATACCTTCTGGTGGATGGTGTATTCATTGATGGTGAGGCCAGCCAGAAGGCC
ATTGTGCTTGCCACGACCTCAAGATATTACATAGAGGCAGCCTTGGGGCTAGCTGACTGGTTCAAGAAGGACATTGCACCACCGCCATCACCATTTGAGG
ATGTGCATGGTGCCACACTCTTCGAGGAGAGTATGGCGCTCCTCGACCCAGAGTCAGACAAGGTGTTCCATGAAGCTTTGGCTGCCCATGACCATTTGGG
GATCGGCACCGTATTGCGGGAATGCCACGACTTATTCAAGGGGGTGCAATCACTCACCGACTGTTGTGGTGGTGATGGAACAACAGCTAGGGCTATTGTC
AAGGCCTTCCCGCATATCAAGTGCAATGTGTTGGACCTTCCAAAGGTGATCGAGAAAGTCCCAAGTGATGGTATAGTTAACTATGTCGCTGGTGACCTAT
TCCATACCATTCCACCTGCTCAAGCTGTGATGCTTAAGCTTGTTCTGCACTTCTGGAGCGATGAAGATTGCATCAATATCCTGGCTCAATGCAAGAAGGC
CATTCCGTCCCGCGAAATGGGGGGAAAGGTTATTGTCATAGATATAGTAGTCGGCTCATCATCCAAAGAAATGTTAGAAACCCAACTGTTGGTGGATATG
CTCATGTTGGTATGTACAAGAGGACGGCAACGCCATGAAAATGACTGGAGCACAATCTTTACAAAAGCAGGATTTAGCGACTATAAAATCATCAAGAAAC
TGGGACCTCGAGGTGTCATCGAGGTCTATCCATAAGATTGTGTGCCAAGTGCCTCGATGGTGTGGGTTATGCTTAATGTCGTGAGTTTGATATTGATGGT
GTGCTATAAGTAAATAAGGGCAATGCCTAAGTTTGTAACGAAAAATCTAAGGGAACATAACTAGCTAAAGCGATATGCCGGCTTGGCCACATCAGGACCT
ATATAT
page-top