Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig15
Contig Information
Length 1309 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12h18    rwhsd12h18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0147700 [Oryza sativa (japonica cultivar-group)] >gi|113535417|dbj|BAF07800.1| Os02g0147700 [Oryza sativa (japonica cultivar-group)] >gi|215765268|dbj|BAG86965.1| unnamed protein product [Oryza sativa Japonica Group]
Score 602
Evalue 3.75086e-71
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig15
ATGTCGGACGAAGATGGCGACCCCGAACTGGCTTACTGCCTTCAAGGCACCAAGTACTGCACCGGTGATGCTTTCTTCTGATTCCGATTGTTCTCGTGGA
AATAGCCCTACAAGAACTGCTCCATCTAATCAAGAAGAAAAGGCTCCGAGGAAGAAGTTGATGCTCTCATCTGATTCGGAAGCTTCTCCTGGAAACAGCC
CTTCAAGGGCTGGTGACGCTGATGAAGAAGAGGACTCACTTGCCAATACCAGGAAAAAAGATGGTCTGCAATCTAAGGGTAAAAAAACAAAGGTTTCTGT
AAGAAAAGTTCCTGCGAAAAGAGACGATACCTTGGAACAACCCGAAGATGAAGCTAACGAGGAAAAGATGCAGGACAAGCTTGTGGATAATTCTGTCTCC
CAGAGGTTGCCATTGACCATTGCTGATAAAGTTCAACGTTCAAAGGCATTGGTTGAATGTGATGGTGACTCGATAGACTTGAGCGGAGATATTGGAGCTG
TTGGCAGGATAGTAATTTCAAATGGTCCGACTGGAAATCATGATTTGTTACTGGACCTGAAAGGAACTGTGTACAAATCAACTATAGTGCCATCCAGGAC
ATTTTGTGTTGTCAGCGTGGGACAAACAGAAGCAAAGATTGAGGCTATCATGAATGACTTCATTCAGTTGGAACCTCACTCCAATTTATTTGAATCAGAG
ACTATGATGGAAGGTACCCTTTGATGGATTCACATTTGATTCAGATGGAGAGGGCGATAGGCTTCATGAACTTAACGCTTCTCAGAATTATCCAAACAAT
GAGAGTGAAGATCAACCTAAGGGGAAAACCAAAAGGAAAGCAGCCGTGAAGCCAGCGGCTAAGGGACAGAAGAAGGCAAAGGTTGCTAAGAAGGGAACAA
GGAAAACCCAAACAACAAAGAGAGCGAAGAAGGCAAAGAAATAGTTACTTGCCGAAGAACTGGGGTATTCACTCTGAACTAGTTTGTGAAATAGCAAGGG
TGAGGATTCACTCTGAACTGACACAACGAAGCGATGCCCTATAACTGATCCAGGTTTGGATATAGAGTAGCTATTGCTGAGCCCACATGTTATGTGATCT
GGGCTTATTGGTGTGCCATGTTGTACTTTTTTAGGAAGACAAGGGGAAACACAGTGTTGTAATGCTAATATCATATACTCTGTACTGGTAGTTAGCCAAT
TCAGTGTCTGAGAAATCAAACACTTGATATTTGTTTGTAATAAGGAGATGAGCCTTATATGCATGTGCAATGAGAGGTTGTACCACTGTGATCCCGTTGT
ATTCAAATG
page-top