Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig14
Contig Information
Length 380 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd12g10    rwhsd12g10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0124900 [Oryza sativa (japonica cultivar-group)] >gi|113594686|dbj|BAF18560.1| Os06g0124900 [Oryza sativa (japonica cultivar-group)]
Score 206
Evalue 3.90111e-15
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig14
CCGCCGCGGAAGAAGCGATCGACAGGCGCTCGCGAGGATGATCTACCGCAACTGGTCCCTGCTCTCCTCCACGGTGGTCATCTGGGGCAGCGTCGGCGCC
GCCGGCCTCGCCGGGATCTTCCTCTTCGGCGGCAAGGAGAAATTCCAGGGCTATCTTTCTCGCGAAGGTGAGAGGCTGAGGCAGCAGGACAGAGCCATGA
TGGGCAAGAACTAGTGCAGAGCACGGCTCACTTTCGACGTGTCAACATGTGAACTAGACATGAAACGACGTATCTCTGTGCTGTAGAACAAACTTTCTCT
GCCTGCCAATGGCACCTTTTGCTTCCGGCCCCCATGAATAATCTTGACGCGGATGTTCATTCTGTTCCCCAAAAAAAAAA
page-top