Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig11
Contig Information
Length 978 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsd7a06   
Homology (BLAST) Top Hit polyubiquitin [Zea mays] >gi|248339|gb|AAB21994.1| polyubiquitin [Zea mays] >gi|33323474|gb|AAQ07454.1| ubiquitin [Musa acuminata] >gi|52076878|dbj|BAD45891.1| polyubiquitin [Oryza sativa Japonica Group] >gi|218198760|gb|EEC81187.1| hypothetical protein OsI_24193 [Oryza sativa Indica Group]
Score 1051
Evalue 2.09528e-114
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig11
TGATACTGATGTGCCAGCAACGGTTTCAACCAACAGAATAGTTCACTAAACCAACGCAGTAGGACTGACACGGGGATTCGACAGTTTTCAAACCAACACA
GTAGGACTCACACGAACGAGAAAACAGTTCTACTGAACGACAGGGCACCGCCCACCGGACGACCAGGATAAACCAGCAGCTCAAACGACAGGGCAATTAC
TGACCACCGCGAAGACGGAGTACCAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCTGCGAGGGTGCGACCATCCTCCAGCTGCTTGCCAGCAAAGA
TCAGGCGCTGCTGGTCCGGGGGAATGCCCTCCTTGTCCTGGATCTTGGCCTTGACATTGTCGATTGTGTCGGAGCTCTCAACCTCCAGGGTGATGGTCTT
GCCGGTGAGGGTCTTCACGAAGATCTGCATGCCACCACGCAGGCGCAGCACAAGGTGGAGGGTGGACTCCTTCTGGATATTGTAGTCGGCGAGGGTACGG
CCATCCTCCAGCTGCTTGCCAGCAAAGATCAGGCGCTGCTGGTCCGGGGGAATGCCCTCCTTGTCCTGGATCTTGGCCTTGACGTTGTCGATGGTGTCGG
AGCTCTCAACCTCCAGAGTGATGGTCTTCCCGGTGAGGGTCTTCACGAAGATTTGCATGCCACCACGCAGGCGCAGGACAAGGTGGAGGGTGGACTCCTT
CTGGATGTTGTAGTCGGCGAGGGTACGGCCATCCTCCAGCTGCTTGCCAGCAAAGATCAGGCGCTGCTGGTCCGGGGGAATGCCCTCCTTGTCCTGGATC
TTGGCCTTGACGTTGTCNATGGTGTCANANCTCTCAACCTTCAAGGGTGATGGTCTTGCCGGTGAGGGTCTTCACAAAAAATCTGCNTACCTACNCCGNA
GGCGGAANNACNAGGTGNAAGGGNGGANTCCNTTCNTGGAATNTTNNTANTCCNNNNNAGGGNACNNNCCATCCTCCA
page-top