Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig5
Contig Information
Length 764 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsd20d09   
Homology (BLAST) Top Hit hypothetical protein OsI_00313 [Oryza sativa Indica Group]
Score 212
Evalue 2.37325e-15
Total Hit Count 27
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig5
TACAGAGGGGCTACACAAATGATGAGTTCTCGATTCGGAAGTTTTTACTGAGCTTTTTAGACAACTATATATTTATTCAAAAATTAAGACAAGCAATTGG
AACTGTAATCCAACACTTCATTCACAGGCCTTCCTTCCACCCCCAGCTTGCTGCAACATCGGCAAATGGACTCTCCAGGACCAAATCAGAAACTCCCCCT
CAGGCTCGGCAACACAGGGACGAACATAGTACCGGTTTGATCTTATTTTGGACCCCCACCCCTAATCACAAGTCCAGATGCATGCTTGATTTGATCCCGA
ATGCACAGCTGACCAATCACAATATCCAATGTTTGCCATCGACTTGCGCAACTTGTAATAACAATAATGATAAGTAACAGCAGGATTACCTCTAGGATAC
GCAGCATAACAGAATTCACCAATCCTTCGCTATGAACCACCACGGTTCTGATTCATGTCAGCCTGACCGCCGGCATCAGGTGCTCCCATGGGCTGCTGAT
ACTGAGGTGGCAATGATGCTGGTGGTGCTCCTGCCTGGGAGTAGAAGACCTGTGCGCGGGGATCAGCAGCATACTCGGGGTACCCATAGTTTCCCGCCAT
GGTCGGCGGAGGCTGCGATGCAGGATGGTGGTGGGATTGCATTACATGGTGGTACCCCATTCCAGCATAATTAGGGGTCGTGTTAGGCCCTGGAGCAGCG
GCAGCAGGTGCCGCGGTTCGGTACATGCCAGGNTGCTGCAATTCAGGCTTCATATATTGCTGAG
page-top