Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig3
Contig Information
Length 684 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsd9e11   
Homology (BLAST) Top Hit hypothetical protein OsI_27490 [Oryza sativa Indica Group]
Score 514
Evalue 1.82359e-50
Total Hit Count 147
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig3
CGGCGGCAGAAGATCGGCTCTTCCTCCATCCGGTGCCGTTCCAGCTTTTCCTGCGCATCTTTTGGAGCAAAGTTCGCGCCGGAAAGCCTTTTTCTCGCTG
GAGGAAAAGGTCGCGGGTTCAATCACAGGTGGAAAGCTCGTCGCTTTTGCTCCCCTGTCCGTCTTCTTTGGCGGGGGCTTTGGGGAAAGAGGAGGAGAGA
TCGCTCGCTGCTGGCCTGGGCCGCAAAAGTGACGGAAAGCTCATTCAGAAGACCTTGGCTGCTAGGAGATCGGTGAAGTTCTGGTTGTCATTGCAGAGTC
TCCGGCAGATATGTCTTTCCGCAGCATAGTCCGGGATGTTAGAGAGAGCTTCGGAAGCTTATCAAGGCGGGGCTTTGACGTGAGGATTTCAGGCCTCCCT
GGTCTTTCCGGCCATCATCACCGGGGGAAGTCTTTCGGGCCACCGGGTGAGCCGCACGGCGGAGCTGTGGTGGCTGATCAGAATGGCTGGGTTGGTCTTC
CTCCTGAATTACTTCGTGATGTGATGAAAAGGCTGGAGGAAGGCGAGAGCACTTGGCCCTCGCGCAAAGATGTCGTCGCTTGTGCGGCGGTCTGCAGCGC
GTGGAGAGAGATCTGTAAAGATATANTTCANAGCCCGGAGTTCTGTGGGAAACTCACTTTTCCGGTGTCNCTTAAACANCCAGG
page-top