Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2
Contig Information
Length 897 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsd7g10   
Homology (BLAST) Top Hit hypothetical protein OsI_00313 [Oryza sativa Indica Group]
Score 387
Evalue 1.61178e-35
Total Hit Count 25
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2
ATCCATGAGTTTTAAATATACAGAGGGGCTACACAAATGATGAGTTCTTGATTTGGAAGTTTTTACTGAGCTTTTTAGACAACTATATATTTATTCAAAA
ATTAAGACAAGCAATTGGAACTGTAATCCAACACTTCATTCACAGGCCTTCCTTCCACCCCAGCTTACTGCAACATCGGCAAATGGACTCTCCAGGACCA
AATCAGAAACTCCCCCTCAGGCTCGGCAACACAGGGACGAACATAGTACCGTTTTGATCTTATTTTGGACCCCCACCCCTAATCACAAGTCCAGATGCAT
GCTTGATTTGATCCCGAATGCGCAACTCTAGGATACGCAGAATAAGAGAATTCACCCGTCCTTCGCTATGAACCACCACGGTTCTGATTCATGTCAGCCT
GACCGCTGGCATCAGGTGCTCCCATGGGCAGCTGATACTGAGGCGGCAATGATGCTGGTGGTGCTCCTGCCTGGGAGTAGAATACCTGTGCGCGGGGATC
AGCAGCATACTCGGGGTACCCATAGTTTCCCGCCATGGTCGGCGGAGGCTGCGATGCAGGATGGTGGTGGGATTGCATTACATGGTGGTACCCCATTCCA
GCATAATTAGGGGCCGTGTTAGCCCCTGGAGCAGGGGCAGCGGGCGCCGCGGTTCGGTACATGCCAGGCTGCTGCAATTCAGGCTTCATATATTGCTGAG
GAATCGGCACGGTTGGCTTCGGTACGCTGTCAACAAGTGTCGGGGCAGCCATAGGGGCTACAGCACCAGCAGGAATGCTATACTGCTGAGGTGCATTTGG
ACGCTGCATAGGGATGTAATACATGCCAGTATTTGGGTCAAATGCAGGCGACTGCTGTTGCTGCGGCGCTTGCTGAGGGACAGTCTGCTGGTAATAA
page-top