Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2526
Contig Information
Length 1683 bp
Tissue Shoot grown with cold treatment
Clones 20 Clones [Download: CSV  ,  FASTA ]
whsc1g02    whsc1n16    whsc4n24    whsc5c20    whsc11e17    whsc12j21    whsc13l21    whsc13o04    whsc14j11    whsc15b08    whsc17d13    whsc17d14    rwhsc4n24    rwhsc12j21    rwhsc13l21    rwhsc13o04    rwhsc14j11    rwhsc17d13    rwhsc17d14    rwhsc1g02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha tubulin-2A [Triticum aestivum] >gi|90289598|gb|ABD92931.1| alpha tubulin-2D [Triticum aestivum] >gi|90289600|gb|ABD92932.1| alpha tubulin-2B [Triticum aestivum]
Score 2174
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2526
GGCGTCTTCGTACTCGCCTCTCTCCGCGCATCCTAGCCTTCGCCCTCCTCCTTCCCCATTTCGCCAGCGGCGCAGCCCACCAACCACCCCCACCCGCCGC
CATGAGGGAGTGCATCTCGATCCACATCGGCCAGGCCGGCATCCAGGTCGGGAACGCGTGCTGGGAGCTCTACTGCCTCGAGCATGGCATTCAGCCTGAT
GGCCAGATGCCCGGTGACAAGACCGTTGGGGGAGGTGATGATGCTTTCAACACCTTCTTCAGCGAGACTGGTGCTGGGAAGCATGTCCCCCGTGCTGTCT
TTGTAGATCTCGAGCCCACTGTGATTGATGAGGTGAGGACTGGTGCTTACCGCCAGCTCTTCCACCCTGAGCAGCTTATCAGTGGCAAGGAGGATGCAGC
CAACAACTTCGCCCGTGGTCATTACACCATTGGCAAGGAGATTGTTGATCTGTGCCTTGACCGTATCAGGAAGCTTTCAGACAACTGCACTGGTCTCCAG
GGATTCCTTGTATTCAACGCTGTTGGAGGTGGAACTGGCTCTGGCCTTGGCTCGCTTCTCCTGGAGCGCCTCTCTGTTGACTATGGAAAGAAGTCCAAGC
TTGGGTTCACGGTGTACCCATCTCCCCAGGTCTCCACCTCTGTTGTTGAGCCATACAACAGTGTCCTGTCCACCCACTCACTCCTTGAGCACACTGATGT
CTCTATCCTTCTTGACAATGAGGCCATCTATGACATCTGCCGCCGCTCCCTTGACATTGAGCGCCCAACATACACCAACCTCAACAGGCTTGTTTCTCAG
GTCATTTCATCACTGACAGCTTCCCTGAGGTTTGATGGTGCTCTGAATGTTGATGTCAATGAATTCCAGACCAACTTGGTGCCCTACCCGAGGATCCACT
TCATGCTTTCCTCCTATGCCCCAGTGATCTCAGCTGAGAAGGCTTACCATGAGCAGCTGTCCGTTGCTGAGATCACCAACAGCGCCTTTGAGCCTTCGTC
CATGATGGCCAAGTGCGACCCCCGCCACGGCAAGTACATGGCCTGCTGTCTCATGTACCGTGGTGATGTTGTGCCAAAGGACGTCAACGCTGCTGTGGCC
ACCATCAAGACCAAGCGCACTATTCAGTTTGTTGACTGGTGCCCCACTGGCTTCAAGTGTGGTATCAACTACCAGCCACCAGGTGTCGTCCCAGGCGGTG
ACCTTGCCAAGGTCCAGAGGGCTGTGTGCATGATCTCCAACTCCACCAGTGTCGTCGAGGTCTTCTCCCGCATCGACCACAAGTTTGACCTGATGTACGC
CAAGCGTGCCTTCGTCCACTGGTACGTCGGTGAGGGCATGGAGGAGGGAGAGTTCTCTGAGGCCCGTGAGGATCTCGCTGCCCTGGAGAAGGACTATGAA
GAAGTTGGTGCTGAGTTCGACGAGGGTGAGGACGGTGATGAGGGCGATGAGTATTAAGCCTGCCTCCTGGTGCTTTCCCAAGGCTTGCTACTGCTATCCT
ATGATCTGCCCGAGTGGCTTTATCTGTTATCTGTCTGTTTGAACGTTTGCTTTGTGGTGTTTGTTTTACAACCTGTTGTGTTGTAAGAACCTTGTATCTT
TGAACCTGCTTTGCACCTTGGTTAATATGCATGCTATCTGGTTATCTACACCATAGCCTCCATTTTCCTGTTTAAAAAAAAAA
page-top