Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1
Contig Information
Length 757 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsd5f10   
Homology (BLAST) Top Hit glutathione synthetase [Triticum aestivum]
Score 717
Evalue 6.45757e-74
Total Hit Count 230
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1
TGATCGACCACAGAAATGGCAACGCTGAAAATTCACATTAACAGGTATAACACAACTGCCTGGCCCCGAATCAAGGGTGTAGTGATCCACGAAACAAGAA
TTTGTAATCCGTTTTTTCACGGGGATTATTTTTCCATACATACACACGTCATCTATACATGACATATTTATTCTTCACACAGTGTGCTGTATGTTAATGG
CTGACGTCTGCAAATTGTGCAGCAACTTTGTTCATCTCATTTATTGCGACCGATGCAACAGAATGCTAAATCCATGGTAGGTCAATGCTGGTTCGGATTT
GTAGCTGCTATTCCTGAGGTGATATCACTTGTCGGTCAGGTATAAGCTGTCCAAAACAGCAAATCCCGCAGCAACACCGCCTTCATCCGAAGAAGAAACT
TTTGTTCGCATCAAGTAACCACACTTGTCATTGATGATCACCTTATCTTTGTTCCGCAGGTAGGCTCCATACATCCCAAGCTCAGATACTGTGAGGGCCT
CATGGCAAACACCACCACGGACCAGACTAGCGAGAGATGCTTTGGGAAAGATTCTTTGCATCAGTATGTAGGCTGAGAGAGCATCTCCTCCTTCCTTCTT
GAGTCTGATCAGAGCCTCTCGCACATCAAGACCGTANATGTTGTTCCCTCCGCCTTCACGTTGAGGCTTCAAGACAAACAAGTCAGGGTTTTCAATCGCA
GATTTGACAACCTCTTCATCATCCAAGCTCCATAGCCCTGCAANGCATTGACGGAGC
page-top