Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2513
Contig Information
Length 1788 bp
Tissue Shoot grown with cold treatment
Clones 17 Clones [Download: CSV  ,  FASTA ]
whsc1c04    whsc2p14    whsc3n24    whsc13a15    whsc14l03    whsc15n17    whsc16e24    whsc16f11    whsc17m12    whsc18k20    whsc20m13    rwhsc4e06    rwhsc11m14    rwhsc14l03    rwhsc16e24    rwhsc16f11    rwhsc20m13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 2273
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2513
AGGAGCACGCATAGCCCTGACGCCTTGTAGATGGAAAAACGAAGACGCCAGCATGCAAACCTAGCCACTGTTAGCTGTACAGCTAGAGATGCTTTAGTCT
TCAGGCAGCACACGGGACGGTTGGAGCCCGAGTCGCTTTTCTCCCGCTGCGACGAGCTTCTCCACACGTGCTACTATGTGCTTCCCATATGTGTATTTCT
TCAGCGTGTTAAGATGTGCTTTGATCCTTGTCCTCGTGCCGAATTCGGCACGAGGGCCGCCTCCTCTCGGTTCCTTCTCCTTCCTCGGAGCTTCAGCCAT
GGGTAAAGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCATCTGATCTACAAGCTTGGAGGTATT
GACAAGCGTGTGATCGAGAGGTTCGAGAAGGAAGCCGCCGAGATGAACAAGAGGTCTTTCAAGTACGCCTGGGTGCTTGACAAGCTGAAGGCCGAGCGTG
AGAGGGGTATCACCATTGATATTGCCCTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCTCCTGGTCACCGTGACTTCATCAAGAA
CATGATTACTGGTACCTCCCAGGCTGACTGTGCTGTGCTCATCATTGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGT
GAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGTAACAAGATGGACGCCACCACTCCCAAGTACTCAAAGGCCCGTTATG
AGGAAATTGTCAAGGAAGTCTCTTCGTACCTGAAGAAGGTCGGCTACAACCCTGACAAGGTTCCCTTTGTTCCCATCTCTGGGTTTGAGGGTGACAACAT
GATTGAGAGGTCCACCAACCTTGACTGGTACAAGGGCCCTACCCTTCTTGAGGCTCTTGACCAGATCAATGAGCCCAAGAGGCCCTCAGACAAGCCCCTG
CGTCTTCCCCTTCAGGACGTTTACAAGATTGGTGGCATTGGAACTGTGCCTGTTGGCCGTGTTGAGACTGGTGTCATCAAGCCTGGTATGGTTGTTACCT
TTGGTCCCACTGGTCTGACAACTGAGGTCAAGTCCGTTGAGATGCACCACGAGTCCCTCCTGGAGGCGCTTCCTGGTGACAATGTTGGCTTCAACGTGAA
GAACGTTGCTGTTAAGGATCTGAAGCGTGGGTTTGTTGCATCCAACTCCAAGGATGACCCTGCCAAGGAGGCAGCCAACTTCACCTCCCAGGTCATCATC
ATGAACCACCCTGGTCAGATCGGCAACGGCTACGCCCCAGTGCTGGACTGCCACACCTCCCACATTGCTGTGAAGTTTGCTGAGCTGGTGACTAAGATCG
ACAGGCGATCTGGTAAGGAGCTGGAGGCGCTGCCCAAGTTCCTGAAGAACGGTGACGCTGGTATCGTGAAGATGATTCCCACCAAGCCCATGGTTGTGGA
GACCTTCGCCACCTACCCTCCTCTTGGCCGCTTCGCTGTGCGTGACATGAGACAAACGGTTGCTGTTGGTGTCATCAAGGGCGTGGAGAAGAAGGACCCC
ACCGGCGCCAAGGTTACCAAGGCTGCCATCAAGAAGAAATAGGCATCTATCTAGCAGAAGGTTTTTGTTCATGGTCATTGCTTTTGTTGCTGCAGACTCT
TATCCCGGGCGAGCAATGATCCTGTCTGTCGTTTAATTACTGTATTTCTATTCCTGCTTCGGCTAAACTCCTGTGCCTGAGACTGATC
page-top