Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig2508
Contig Information
Length 1784 bp
Tissue Shoot grown with cold treatment
Clones 15 Clones [Download: CSV  ,  FASTA ]
whsc1c16    whsc3h07    whsc4m02    whsc5g05    whsc12m10    whsc12o22    whsc13d06    whsc13n18    whsc14e02    whsc15l19    whsc16b06    whsc16p05    whsc19f05    whsc20p03    whsc8i20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit methionine synthase 1 enzyme [Hordeum vulgare subsp. vulgare]
Score 2605
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig2508
ATTCGGCACGAGGGCCTCTCCTCCTCCCCGTTGCTCGCCGCCGTCCCCCTCCGCCTCCGCGCACCCAGGAAAGATGGCGTCCCACATTGTCGGATACCCG
CGCATGGGCCCCAAGAGGGAGCTCAAGTTTGCCCTGGAGTCTTTCTGGGATGGCAAGAGCAGCGCCGAGGATTTGGAGAAGGTTGCCACCGACCTCAGGG
CCAGCATCTGGAAGCAGATGGCTGATGCTGGGATCAAGTACATCCCCAGCAACACCTTCTCCTACTATGATCAGGTTCTTGACACCACCGCCATGCTCGG
TGCCGTCCCAGACCGTTACTCATGGACCGGTGGGGAGATCAATTTGAGCACCTACTTCTCGATGGCTAGGGGTAACGCCACCGTCCCTGCTATGGAGATG
ACCAAGTGGTTTGACACCAACTACCACTTCATCGTCCCTGAATTGGCTCCTAGCACCAAGTTCTCCTACTCTTCTCACAAGGCTATCAATGAGTACAAGG
AGGCTAAGGCGCTTGGCGTTGATACCGTCCCCGTACTTGTCGGACCAGTCTCATACTTGTTACTCTCAAAGGCCGCCAAGGGCGTAGAGAAATCATTCTC
TCCCCTTTCCCTTCTTAGCAGCATCCTTCCCGTCTACAAGGAGGTTATTGCTGAGTTGAAGGCAGCTGGCGCTTCATGGATTCAGTTTGATGAGCCCACC
CTTGTTAAGGACCTTGAATCCCACCAATTGTCTGCATTCTCTGCAGCTTACGCAGAACTTGAGTCCGCACTTTCTGGATTGAACGTTCTTGTTGAGACCT
ACTTCGCTGACGTTCCCGCAGACTCGTACAAGACTCTTACATCATTGAGCAGTGTAACTGCTTATGGTTTTGACCTTGAACGTGGAACCAAGACTCTTGA
GCTTGTCAAGAGTGGTTTCCCTGCTGGAAAGTACCTCTTTGCTGGTGTCGTAGATGGACGCAACATTTGGGCTGATGACCTTGCTGCATCTCTCGCCACT
CTTCAGTCTCTTGAGGCTGTTGTTGGGAAGGACAAGCTTGTCATATCGACTTCCTGCTCACTCATGCACACTGCTGTGGACCTTGTAAATGAGACCAAGC
TTGATGATGAGATTAAGTCATGGCTCGCATTTGCCGCCCAAAAGGTCGTTGAGGTGAACGCCCTTGCCAAGGCATTGGCTGGTCAAAAGGATGAGGCTTA
CTTTGCAGCAAATGCTGCTGCTCTGGCCTCAAGAAGGTCGTCACCACGTGTCACAAATGAGGAGGTCCAGAAGGCTGCTACTGCCCTCAAGGGCTCTGAT
CACCGCCGTGCTACCACCGTTAGCGCTAGGTTGGATGCGCAGCAGAAGAAGCTCAACCTTCCGGTCCTTCCCACGACCACCATTGGATCATTCCCACAGA
CCGTGGAGCTCAGGAGAGTCCGCCGTGAGTACAAGGCAAAGAAGATCTCTGAGGAGGAGTACACCAATGCCATCAAGGAGGAAATTAGCAAGGTTGTTAA
GATCCAAGAAGAGCTTGACATTGATGTGCTTGTGCACGGAGAGCCAGAGAGGAACGATATGGTTGAGTACTTCGGTGAGCAGCTCTCTGGTTTCACATTC
ACTGCCAATGGCTGGGTGCAATCTTATGGATCAAGGTGTGTCAAGCCACCGATTATCTACGGTGATGTGAGCCGCCCCAACCCCATGACTGTGTTCTGGT
CCAAGATGGCACAGAGCATGACTGCTCGCCCAATGAAGGGAATGTTGACAGGCCCTGTCACAATCCTTAACTGGTCTTTTGTTA
page-top